JFIFHExifMM*b1 pi$ VBANER KLODZKOAdobe Illustrator CS6 (Windows)ސ0000 2016:11:23 08:45:142016:11:23 08:45:14BANER KLODZKOBANER KLODZKOICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋICC_PROFILE }xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|ICC_PROFILE } "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{ՑICC_PROFILE |{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmICC_PROFILE jmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"ICC_PROFILE pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:ICC_PROFILE N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$ 2016-11-23T08:45:14Adobe Illustrator CS6 (Windows)BANER KLODZKO BANER KLODZKO C      C  " }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?LsTZ-2Ʋ$f.5rnoZ $E9KbDȎ=648#|N6?YyNUܼ[_ >늇SOZHW k. ZO}B--7u`;Bh68$>ϔZ,| ԱƋq|Ftm5w 7^ >]好 mmΣN?{x .X¶m`U7_1T{QBItd+qz~G_fddPR]477j:^b?v[$u$'M. TPzV-P_S|;\xX4}6?:8NHAc}k]7LP!F6Nzg֧~Y!Mu4l "d}_ZV4-֑J~(ۢ WOZ/u<е,N6濣Iۮ8sm;ׂdwQisOX)F4And4可Z7oI#@?Z½+;^+M^VޥXهҤ杭hsfVVV5J$W:V2n5FζmەS3i 8gޮ}>Nw7[Wʹ0qyvF=H#lus Ah2s)yk_/ozqG=J؊UMHҬ-ce9fCKj~9I][~nrZڭS0oʩC]A%]b$H¦gU y"vӊT_z'm %SCus~"͜H]#/Yב[pz -ȍHxF?G*jYÜy=~]ՄwEZI>Xq嫻fUWV5Ov'Zj:Qe>]-XI捘|`y1yR馍p+[k,cI~cyR:H\f*} nءUc%+Q#VqS J郯r]uYXg~_OsY2䪅P!Uɜ[ʯy]r8GQ\]hyuKe-ZkG֯GkF3?f;|g|L#Y?Q+~xĒxgW?f酄ڋy㜊s5gx_7u) d.2%n =5YH|OuuwqthV`+<;o?.<&6aO:W4vkyܞ0hG%;#S}}&4Z3k 6JF-޵I!5H±acuq=(d$ַja.JlG@y WNsV4>_ _ejb[h.zU-?*Anp m[*q@)@JߒBu**sK|֢57ؕG FG1o֏/ZmG-#QIT2ˎݙ}*oo6+AZIڝ?4kwIX^ԫ k ݹ7{S4#C:~5amԯTgJ柡Du u>+.9xugβWi6{+A9VXռM?njG_9!?jȖfDR>y :~ GE=㸶l Qp$B,~*ѭ_6ۊnֺ馫}RqW?,|71';3ɯڏz?Ÿv~:gsnڦMq\υ~|eK\~|;dM%M!$ 3@ex+/hS*mF-&ݬRtԹںGZ6 ~>ʓo2Ï׊_/O-uֱ6g-,2;.LW?~+| ~0+M+ֺ|QC4fHIB1 w׍ \]WWG/4Q-v=} cW1*ڧ_ߵGxg~2-JcTŽͤ~S2n qdceoٖF{,n<>8P7cs#$8:,K&ӋiuB^[Z5V|F O3ʤTp#Py&L.~c쿵_t)# x[D"FFR̹qnIg-?? ?w7PxS}n$h[?n?@w_)PkFuDgf|^FL ?ʉ>٘my+㵿? ?|casvqr+ڻuwc9\gևO-p[=i|D^)ol4RIND2ٍ$5}fo8\6mͫ]C*eS?#]t/lew @q=>}--x^ xO..vXG5Y|*ƺOYN+"g>"PʳxiMhw6AՋۡc o-_j<ŶL:WmxŚ{3,361s$xo~wXR6'sk 84SVV<~nT.?^ԟh x.Q?l460pW׉5πX{Ød7lOέ4־^H~U}'_~I}pTBmnWө).rמ}?:f o>fþ,Al8,%~e=א~q:c>#ckkI$Y&f0+(nI=+L/Lf֥fɰU8I'-?/ r/jzҘ6%*:쳭|9^xú]%|Bjb*ʚ\P/d?|SCNXAP HojP,:I6gQWr[D~Ae4˻ởçMfdg8{q߽}Z˚›{_xqk{EBy ھQ2O0XܼrZ+Zw.c5Ӊ3 nk?.ڠrO#_ǽ3_?]vz4?ךƖ6s^IrAJ i|3n#It߳D\mfqNjs6TUi+%{ Yە]~^Wd:P/8M~" uakcdmcF_%hπtZң4쭕eKjxipJXOJOMIVr? q O<ϧLT_.gιk½;\׮'CjQ#M'-׎kּ⟂ aypvs$q[兺׾K 2|8y7~ol_@lDF_q݄c Ue~ э*Mgkw*Ҽ1\ujr;tO4moq+\(474ͼ sҘU}ה9Ko5W6?wH{\*RA$. [`*oocfWT?fj'Ͱr +C>b&U[C,V:{@ʣ'zcdzv:iz4A'WXz<}*YZ;iF3ټE.Km37ԢMOH4+5Y&%Yb]s>Q=~4˨^! $p^[py_nxw<;ke5ib=6{?&ǬxnOK=0LVm &w`|YCG{ᛥM4fI|bEXkO^ïAl ֛9|`x=x5WZj acٛRf᳚[bYV,Fp8J~L2@⿘?Fxb+I-pr~@4߃>Ƽ">a:a p~;j8V=+6g/P[a ǘßz?^ Y!u {8r=GHW9V#vWZH( X㮽c;\ԉLE~8u?:n&;>xCMӿGg~V2hzȷچi!>~zj}M~~Ȱ߳'fp3h~X+b=ҾVHE!?.?v9٥cH}D6CR>nkDɗ}v7Ӧkciz2HxGE4,Zm,A=zOڪZEw_,I}ԏZREX X..'}lGlSZߴ\z#E )@_%w< O|E|Yth!E/_LWnA<VؗI\ *!'i]LPv۟2?I]p}soZ+"3[IlԄXoe`)RUcBʧ u<TP49>t3KQ-g) pk\2mm4j)*zsry;l |[͸Vn<1@@=eR+C쫟Jwؤf"Q'EP8K/}*_̿2TmekJm733k27ͅb2=>CPűkP2[+s/ =kfUHҌө?k$?O2xOw|QyT`Q=?~.|;{ {K?jϦE4vЩ +JJq Ǧ+ܾ)GWk1xNS$2G;;]BL1PÞc>5Y'W2Z2%)EZɾ>0*PafI#E e%v2"BvN*aC97uc}6&ּ1Bj}E#sқ2ᇃ`?4&dgb{Sv*c,Iٻ¹?ٛWt߂53/ii/4:U=JFu0I 7:q_3:yj'hٻӡBB0I{C }3G&>hT  J̅Ԛi?o\mG/\zqg_t# u{8QZ231n ײZ/o~(h?4 qn[|lFFVG1(ՊQi;&N*usEc-?#*ɭ>a ~I_;rI&rھ]?h_ j vopzlDm !B[%C9aqޣh~IiA1BdK r$pr!MS+;]S[537_<"#WX1dvue\Edt)|][ھۉsqo vad¿?~ֺ \𮡥\[<щ-G!+'/*Ϸ.|lWş*3}6>mf#h`˷#=k8>G{vz-?#(Rַ| {wmj{.>7 _<;-3S߻ }Ÿ+rrF1޽3|_9Cx_v5X KyY/Xl9M|?b=k&mzKhv$PB`J%Yf>*)Jdٷt֗qTť&oksk(.H^J#,N齂ԕU__ 4x &xwPxo|NHX\g}Us|=cj>/ I\y|"M3yc')|lռ|\e5RZ ީךsg9*y*MIZd^MosaFOVzj|#ͭ? tOG6Fee?B_,|g=ZBo$SG|۠?u''=b_ō@{!x'oKxuS$b2 /b. 㸆*/i+&V3T..K>6=#N' K3m'|I*4;1'n?xvY?½ÿ_ ~/>fmilѳh:>rMͪ7b_.dNr}?fon`vq _ ~~0~~ bx7ad~fi#]Ŧ#rz(e f8/4ɩ][O:D$`?61|GKhB'[i'xJX(W{.>&9_Yf\f[ rk?⬺]k~+}XYRx2'ѐjSgtݗ|YoM: *+L#EfL3 mxO#N>*7f߈r>+[*jTV}gNK]k3^xU^6 8w2mU=+`Tk!EeO#ly+_GVEg"̭#9x=zVB|_x^&_tXUrϨیvhcHڵfm{+{#ԕVZRjo/|včG;15G4,bT;wP;:(~1a>Kh|;gih;fRq\k 6L}7toY?O,`2]/'9 VK\/<}ngQՒZRkf늜Q?O4IU~?#!h7Fۢs q~_|~I ]F| `2iwi.wFI4>*X_}nH|C ٝ@ t013zH ~|W_bմ{q|Q U̬h=bX/_'M;4sF,a4i37I!x:_io NciR\!&7Q ۫«Y 1੷I=,LX3nFOɭav~޶o=>:sxj¶~Ķ~0jMk ˦YKE_l>ja1OZ/*v'РYo|nGNb(׳I=[VTL2\G'_vIMSk?.4m*~Af+goӴqkXby|V~Ѷx.9>t.T1pQg0(-xѿ:|Q z4Oq MQ8 a\n?'Jm{-FVm4ݥ0ЇŬڋ>'aI5{'ﺇ}' _ \Zk w\t*ǹ'?o.=J/qornFV\2+ C]c`ĿaԵ+t1=Y:w%vE~l`լچ}ƕu)^7!`79+>s:9|6> 1vzvԜ]ZRgJVmIxg-m?Huן͏q?wՉ_oڇ/~87G ; iZ F}l_ n4AbRiR6ݴIl2z~4V xMKN0wj|6}{|M5e}ȜƳ*-jvZgcsj09,OAHͷ捿]u v:y7л&}NGYIwhص}]Yt֦̖. <|ힵjk4^Yn|7? QixW:M$1Y%V"T*9nE@տ,f˯n Ϛi2yZ[~^͜}L.d0DkDFk ?@ u: >[;u(($V<:s\Bn4^˘WjY*\oM}t2jo"®4ceOϥ_lo5,ZlF mN%eDH~? UksdKu|M~{O?&z9m5]\eԬ4̯ܲCTV፾u ]FfjyS+Ils}=$Zr*[q *ItU$;@t -Y463Vujm&Hnoiėڙ~D~lj%0r>zfֺbwc/s_L5OۗvF]V񅾓%̑\$elaFsq\mzo6Veۛ;q-϶&? hIV*:;r_H9-9/[[s,WQ\`uVRS[+E@ ,`O|wZqkռ )b؛I/fk]X]iZ96W= 5 |"j-/ 6ֿx+JoHh%{ךEYǟ)5sZdhj>綇s+X_^ 5{-\A1pZoq(e<ifKW)u$[ :$uARXuf^44l~Һ/kɬG;J5\H 3(^q_w͞q۩&㈵珛Lo+e3L-Ύ+dE~Gp7ֺS5]H1QQ&GBG eTRB}koP+iq2ޙUOKX&"|Z~,qy"䢖 ΛxoxT<-1 9bx k> =..c+ʸŭd^EJ7c+EI&;ss#g#8?I0þ"J'Y-{PAݜWgċk1^ D6:^޵ދ] BO;cqըw%Wo>{xDe;F~+O+9%kQUS 6v]ߘ_:C?2K{65rߟ3WgyYzhisEWi*۴k/O`mܧ|WW_rY&vdZ4m'{;~~{+A>@+"oPmúmFkf&}p`HgxQKzx7S߁.tȬ^Ic<$mU}]jW۱تRpr^_ |K~oԹ-!j/|=cIkˌ(63tc]-^j^ 4;=HuqJ͛pvQ9\.iSxRU7)5XD$_dWO))Fv]*u97=Ef@LyN)eej0ܹCĹ?JM8;G{ŷjE[i>yԾL*v,{(EMsIO]§]~l~5"ǺGs&z5CW"i?][rěEw]5T}≜qޥSqXdkQJNə;)@ q&p_7ڭV7pî)s L}?JU#_fITLde8ヴT4m ڡ 6N"6r>8k˾ }ySkf~p)hUU^jꦲɹhC,qbkŒN:8Yصv:Z=t/,6 6ܓ|q*ӮӁ`i11q֕)5E{yo O匮x-OI %לU*+7*.eoSjwk$m߻xqYTlu7HG k rK3zm{ԩY[?+:NwKVcӧVJ7B;}Рu$ߝR^<]-!J75zFWP^p`eFVt"%UsҧeQn%)իnjƬYF *r.>\ix$/5VUm x4օ2/[NIo?\^WE75a˅PZ!ݳhU?tr jDuJI2%wFV&gڪ[x޻ vךy~&ݴ< k)c64T߷l#뚓ɍߕzv{ "i8Z["=WqM(2BWo&,kBF04յ[*KgO}@scn´<і+(t N?Mp力QuqYGv*9znoBN\"|}3~?QӏR꯹JU\OR\2 tScGz?H|D7ʊ0PFz折\ҊsTmo-שܿ:7/rSTHA#2deU`˜7\Dg8wo#F=]>hc?қ_W/Z;;C?T{z*cO*w^ו;|ɚIrc#mCc 7@a"eI,98?3EW_}d ?JkI&6@ iw0ݵ[g>߇YwqJ+׵~YfHm?¬+XG|hw? /*eC,rQ叧FT\}}u)\65UUN;,imVCU>[p\dY[-Vyth}Uܙվ_3\`~ QTcisۯZ v9bz[tsE ы˰#aڱh S$l?Xs|L拍m<&ؗ̄ff4 T *ҷ^PWxČp[ɮpu/4dȼ]ޗ4Ss=yb(9tXnuym2ڴK?Gބҧ6r_YȚƚnmw,F+MJ˩[m_+mht~$k&kɮ%S#(ew>nϯOQHJP̻lt5qTFd [=ZfMtVN}k[^1S~[kMSZ<1Mỷ(ʸe*~RßnwgE +J0R/Kfݱxx|ujg 9S,1Ϩ _OʘBV<"f/w>;xcI~, GN,%JdYN}k{g;ߴCv?hcWoZW^ǏxkC^Am& Jwcq_?Sʚmm,Ғ}qy?lÿ,Ms&_,8(܏{cΌ]~$|oxGӾ+d"1~#H$01ޱNicTլt]}CP!If'!l1lC~~ZG=>gJȠ, 37.$+,ǽV*ȵot\4mgR-֦KrTl~5ikFŚ0XRP3g}K~*'۟~ >?d֮|7{-v||:Cҿ~SI#뢉lh L̯&]I' ӊ???>OĿᯇ5K 鶑>"Ua%W M'{<3qo\@kO EAEq+sPVUGUi2UGopH?e?A?i_ x>6 %/dK `^3{.&?z6HyBN.)ӳ]ח]cտNwᧅ4 wNԢu]>8az28澤_7xO;&kO# d0 9|WUl:Um %ɷW3um@iwm#pVkyBp\;.kn#ӥ,\⬒å)I'lHRY򗯡O߅ 7sT+?k5+cbO:kܱm ?wˊsL4(ԔbRj>g;ѩuw^fe8SCkmK u7@gg}|Bie>e?Og[+-$ԤLoA&pH|W/g\t>7ɧao\iw1FV(1+ͧBTkIIz^ׁΥx+.ƿ)&|1G8u2ɉeܱq;]G|;[??%5|Yj3=5YƁ uxVWLZ+_I(K $ctM~ |=9@ufmf@$N2G_x ⯇a[9kKHU_3ߒ@ __?Ҿ''jk*8 ~fWx;q߭|Z~џ#/:Od#ӜN92"2j9sfMjcF"4};.qͿ麷?/ϨBsjNpָ[ os /·%H$h_1>o\ǟ|Tj> :嗆|'wc8ʜ-V,Fk;Tt+/6GBeX&׹fTƖ:)wqmKcE I:j+h:/t.2^KAv,&&y6vg Y>zྑkgKY$EwF#'5<$og,f?#>_>X4idz J2ݒm$.<5Jty}-^z_ۋAtL<+ugeuw Kr2zS_l|a!GxP'JYI_ x^;yIo /Z+)qZ3*>ٯ77O Rgz_kcᾞ ;Xۻ}#tB~F˧LMI_|ֶ;ˉu)<=4d8I+G~_^KhRYFx!Ϋ$[+'_ÿ|ecໍKQNuuvsm+);C9ʌc+n+%bdiejӧ ǒi/$ 'Oo/-ёNc*fO\g~JxGo"-.4zHa$ˈ`lWma|9{ᑵ{%U =ߖ* 'P}E|s2u5#jWȥwFtk;?,ͮJmbs|GEw(0'qOئַg\o1v\ݷaC/kmZCokqm<)iٷ!S|W@$q_MMkչ~4ZCjD#0wco̱J{I8m& p Ti&Z|'%a[9V ΤB;,fَ]z!.YnnhщS)F$"(<f?'xV 2X>HY$=?բ׀7A>$}{-g%58"cSvm6Z\}poʛmI5B|v)-i%ΥZڤ1_x@rx^_z7^ڥAho%d#vnq~N^Z%kެmڮ_-q.gi!YyOWi<ݿw_jxf3QNͻn$( ׂ~f:d[\2p+cଞ 1+(Qu;b?'QߋwKg,w0|6+⮓oKL kfo|Je}~YFM&kdgW<=+!Gm-6ul7j2E$#q^qI"3yDkڪ d5mq Ŧ`pm"߁Shvd͍8}+[_0߂C!׵]&| f@ˀr{j]K U3-1yuUпਞ kpůnq sje^ ug)si՗<`ֽzЏ$jއ~h?_6:m}f;i6,C<-_KbMjL̸8e`Hްzm EIFbM7f+K8YɟS~מ;nX|5CE\K=SNH1G`V\}+_Z9ߋ}?Ö>*4ͤMw5'2zk? />%|/3/?z!ed*_G|U/5MJ^u{SqţpW'5֫(ۻo[=m뱶.M)==K_tԮGy6`td9K |%d;GGxM$!A'?Oȥ >",އ) 6U=5c? P \q-_Q Y>v[Z]WӲZ]>ͤu ~:&Z(HAiYP>lW @^Zͩh Lv2DzeW=r83i? ԖA,ZB˟?'iy'SMӬ4.P-g)!d&nαTG4&m3 ͥ揠?~QF42u!?`bd@9CRCB?/IQ^"Ь.LSIk]G:,$]x>/ gk_ -V3+&YXVywޏ^J~6i7[.`ڥH)c5e1XxCRݬlcRn"RgO}ֹƌM05rȦ T3dvazuكߵ=ྍk"Ouf[S8c 2{W_!M$M/5 yMm|X@6W>bd#ZKp[F;NO#1PgF>N/vrƔ0tߙ; u76~/M`;K7>VԴB;:ov`xa_÷5O0T:rs7qgֿ pfM c?~krʑ7)BM&׹tiQi3k[?xrSOEyy_d,18Zfy1 )FP2jyePř5jmfcol"3]?mdw4f~1Rvw_d!hgTg}W3s]v_N?F~ksl>.UgůAy)|pO*,_idit~.ih@˺uן^|uQčpf,[cxjK8U By_?m16_ m㕿{m9tnz8-4yl&UWڼhY2ު;@1E}W!a?+"Morf} نC_ƾTTFfXylz|4aj2>,x[㔟 |k ֲJ7n]OhwxGYӼ錿e7RG+( vHzKnHw㒬y"s&|[.iek&+K 9.ed\`Efk 67$5]*%Ķ0O2\ᇗyN} ~1KfV&l|#6hK jv&G^7?eY6V7WɦiS(c I:{W爮uꚅm. ȥ q@i#SfYΗ}*搑2^8_w[R!T`/T6%(3nlӑHv,mҾ5E jڋŖL*kD,ߕul[ żoq "6{@ ZCch+ c'#Gմ_I$dG:Wm_oZ=-|#CQ0M v6t?<1Iac@?g׌,m"Zo#UUo2sc_'O^8A\bvZww(R Cp kX>⼽lkJiI?ji]I>LFMD**9e{UO|Q']k$T(BHUU$ny)N$&oͧrk8$q(PA6}rkO_9 5Iޫj7hyn(F3#S qR9ԧw}vCL}};ˈQ. UwQ_%GnV?xO5_4 3v묋{`US'R Kϕ8yg"<7~>*YF/jSbhJXT|I!,zcSk3U_B+r)8+]k_T{_֍h^AJtZE4 \ːvzVO 5rk_BK{ ##dH_ƿ(ՍwgQ!foq$ҽޛ]p1.=>zR5Ѵ\U8='<\;5jއmJ9a8wm'Z|3WmZ]6|M x>խkom]OmQnÞrAݜ_GlUI)_܍ݎN>d6w&[r\F &Yv<:cV Z7Ix?BE f='P,- o;w`6:=>;x/_> Ԭ+;YuepϿ $u_`fe?)Vi7~wgȯɳ icqU+a8ƥWNVsץΜg}D&[..,ilo y,{?!Udy߲&~6K{y# xU^X/B譭sgU}ݬ/? ~ )JѥS+jy y8|2>&TtoB->8%$9fR~`zg ~U۱zky{~Xöz RJ$=RG?U(]﫹⏄ |gmCcVyC4R#9|#||f~RW鶓xκt:sog˸I@=|;~2X z]_pFTq5լI.[_4מn~P?WR[D|Efp.~ uI#f \:qTmox>`|#J5 i,oVg \_pF6;TqqcןqT n4nfRk7?Pgm-’A&dWeژ|Ym'4Ms{-fHKkiiU_i7m=AP 7ExEViwR^դ[?>hGԡgZ]Π%}8϶W}Nk^oq៉Z:PjqK-ԐFB+M_0S+L.*t98J$wG9IKݻ}O1boɨxCν=W+= XS#~ i><4j=ΥsD 7]r/5ߐ[R{ӻ}u^ j-=mW޶?`/O6▱L񧉮{l\|n$U^W=c_M 1gAN[~nå~D.֜>cڵ:Ť[$akӋZ-kuoCĞ-.y%jcx'm'ܚ?ď D5`iUsM( +,V/CОk#|"ғ$*:|e*a4i$[¶l)Fs>|F>~,cbcBMn(N> hjhz+MX+sW#A{mM6.N+׹Ĝ  …GJUvk1F(|;G^.uyvv#IzK{7- 8hR˃l3UnH *F6:~:tc^WCj9)JME$џ~?5ψ{tX,XdG[YVZ+?ۺ.͠5Hƪd((䂵Y#*kOQ^.#Ml]OMuG5w>o )x^m-{6H#d,~^M};7O?#WKN5FXn+2 ‰bFQ2۫3|Cl0,S5]|\t ]CGuőm *|xw>.𯄴X_Ro.T1F | \dEȟP `Tṭ+6ɞVmI5à TRi6Iv:*fE;~~ך|[GGqjZׄ(+;k帖'7d]WџVc|E|]r\jP}ڌHH'zq_sKc(UuA*l_UլwdhxQ:J Gv&n?Pd;_ ~j5}75/!ŵ$Z/ 1KOY(_2+A3=VLHyRs_?j+Y,'֨ͨxmn˟뺏!ZUuSOO-PQQ.S?3// xetdXN G ! 4CVot[A¢$a%Wy_jhQ򴑎ţMV6@-k3)U<5X7ni+$g*ݍ!Wڻ\V}~О[j>_]VnIХJ%#us3^kύӾƅ l_hԫck7'*_ GR1Wu]AϨ^M38\mƽ _p50\d%ȣQ]-FxW4_xOWO5Th2A%|[5&>8 UZPndf#(K,.E~m~l]Ե;[Qf5Md~{( *նv7 G;U(ݘwIRv75M)\'57Oг~7P[6PσXkk\Et_}9__7;ce/fRV&dQ}5+V߇aY*vg++6@>wWzׇvMe:ޙ9'a4ԑzy+?x|N񕷃i0\^jWCanfAŮ=jú͵Rl~ـ'08Bw% hKCn|'\s^)+yY/$W?&-\3g5zhY^7&rwa+nwiy5C>F5%=(].Ɏ#-Q~VfoV-0εaa_t%i%x@&4L^L:'Hүm3yCq+6&^6G 'qb4I4͏?u*|e |/D+[NK4+!?5)3d_ ?G _Č4d Iԧ_yx/ ogq@+ѺK_hrZko4{_~>YZ ޏh:XYn+6VߴƏEV_)ےa^\Z– Ro\<:T6eI$5㿈ױj0zvlE~2n$)ʰ8?h{  ቕDVi5%}ul5/!f[]WpW&P%k_Gu/}*pݻ۳R/vwR*c^p dzt XЏNo~k fܡZݯ[pJЉ#>f _CXɑRy̿u~V*/̭sMڿf/_ 㤛2L"*Cm ;>PŸݎS?d_:J|Wo_ù O'h1 m`|[kWY|Y'k+5:MYu{_-Y[qb)2e?m ;/$h֞}hJ$X/|E_ {>tF_g{u˸eY8ͻKੀOMQY =*Pn`g7-2T>dh +JHԞ?ZkO--o7ᯃygn"&) fDunQtCb'Iɤz2\iys-Z> \~_-g^)xTx6ci?O4"v*.)\2,l22v2 'RMijӧ5162zs5AC^/>:6&wr,'0cM|_|U[NXw 1~EP9&jtی%gyO&]&q7E'yyxg𯻼Y| :wa7h>,"e]^O4+ 1=k?kُO [~}kV:r[SLg}Զ+8:X4ŧU^-Uqn-6˷n_.HG:)1+c~Jֵ {k YFo:_@@z;!|xg\Wiy|3V77˽mV;e8Zb7qu?:;Y~\ٟG EZZw_|!5#c[nX\Ahh"cw 60~ˊJ!AMU )dҒVC6~-rU=FkړIF?e9W3+O xr 'α-xExn oJ> ;/ugr5{i]ɩʝg3F́4y~]=7N~}+3{/oxMGꚊ%qlrY2e/uX/7<+;=2RD(Rmr0e?0:W|S":MN)'vMQӋO]Zuu~@s/I ~ѯXŰ C!?ʾ?W [c_E&\_ u#PNz{wdkxm#/Yԥ H"2sN+r>3:͔dmWWS+:*ў~ W'efRUկǷ3y~a֯vI ػ>Q& o_>*.%le.X1Uǧtg\qG/Ƽ-$Ҷ+ :,[>׊(%DZ٭(5vnzJ'J#O0[_o 64Q(w$($ezs۟Z(ڥ]"\ 麭t]aWbpyP>}+£eㅕn.;*e4"O.$e*AqT:úhf*ݨ8j]s??+,0is=ɺYfR޼?MG? |+6䗚vCej8D Х*tSnm+]/3yTܤIgWhHFg9B ~~_g_Q~8]&=95k:ܟY *J:)Q?/f_ʾۆ8T\J-k}LNXYZzfyͷC% GdRe.&Iۇ4osE.ʢi9j}7w57*݉ ?z٦7zOSBc!֣flTeޣm-QΊdjDXT|QF|SΒ-SosQno*?*$ʡygzo&Vn5T5 ֪q TF} ٚNt3I4y֬t7|7WLkJE'֝ k$fXR&dm̈scA[F๸QBZRXnJ`y@s"xG׆UkiWj-n3VUMܐw>&|@-MRk;8#ADEcASq\EիXsjcw2lwe ثo"|674q,qH<$o, 57zsW#\EZZgҦXjn/iUD})jЖљ7mbpG'V?? I/kxH/ `onT3G kA-b._fGvFj<[>j*wVXj8R}Ϡ7xZo'a,t;ңTrGp`,w?eoNo ~?>!w } [W7^ⶁo[4"Ir]QܻtQ@kUF$Cܾ.xO]fI56+Te ~N~/mAmu'[%◆mmoc1L&V\HpNs^/ß|@|q5[5nc{o'ş~Vp0;ƜrY"e<\g}4S- FǯwG\~$#Y.(tśYsq+ ?5Ⱦ'hٺ֪|VKGY;5f2?e-Ϣ|OOTmGCw{IOx1Ǣ_39io,qDzU.@x7ž0mcNu|/}g7 WR1BHa_/?A7č[VvgH]. m9<##\8j9>)b5;wع5ZVZϟ$з{T-@r98*K_ձ0Hn+F_~_ Bt+/&7DҾo~*qh 7?ׇ<;5ovn!XEǷnFw;G/\N>$D?a]-4FtEɞ\3m ׽|c7 5Z d\دio ,[|;?Lyd%Ջ.@zW 48 jPMB7?#}O_%Y˄*Qm(齷>f&w^t[4z˫ hS]`yI1lgׁ_A|+S&i[$g1m pq^W?~DЭ%PT)%0Cq.O7MQ #Cֵ6d$-KAeN.eT%(8z4_3kN{6'xZ7iLT|4s(0G''Ҹ_wË|@g⛁TH1,6ay!qנ~ƾ|㏉Z3Dt +)/4b5ahG0vNIO>Կओ|t>,xjM:Š}-"ۈU]}|*W3 VM&g2i□ϮZF鹘cI/i=Pv=}# WM~*^yV A-[6:W;Ԑ:w??fc'_|5w%,T* *C^0\G[.ZZMv<,aM=W uSZ̞g߸`yCoҸ_'1NJi |O.8olCw~'գ4{q z֯f6 !K0x#'1Ÿc !|B^s_ϨE~LK.N1d6K*\Ikw*U{+?^?Tkn;9Z9;~?Wi~^iiw G3h"žBn@_C<;AkZνl ,+ɧғ;Y4Y{_!i>` ՚[5Ȓ*}P2H OJ'WHݝCϔcc2zzW^X5lF.\cRMӽƤ%eyw}n-1ZۺWsGr_cC_ oެ#n/zF+ֱu"\icv*Qʑ02أ_Jλ5O}97&`{f́)T/ϙ+nlѺit9<œEWiyjoO:)DHKϏdj)foͷ2q%j>=xy"?J餏r_R\q9=Tٟ8>ߔwu۷ 'I.eH'`х^5KxJ˒9տGXU`yR]T9n AarѰw[chQ>`+"Yo6?^l0^\_w![ƑpEL*Hq 77b41<(TMV_r*Q_ӓy &!W<&rYN M=o %gI.n_(m+Bl7Er65WE7s3}Q .1M6wbH4`#n'*aqҚk慇¦tio]o^FceU@kG>HjY?w~l+^+OOmqX 0GȪWEYxŶ9~523eFdB+ ~)%b68~Ҭ"v%|ƷYxl>cz|P)W:e| ^O9~nFm8nl֭=}=j72ՏI.kE˛ _;]UG1*[\qo_?'$057RyR vEb4v˶Q|K6}GdӾ'\Ǵ<*0r,⟪PN}HaaMU4dgRI5K=fY cNpI?/rrw奱1QGj7[GqI5EX,SחO2y lq3U5`o~Tj7ʬ#S5Ooβ/v T2mU  MשE5cb%U/(=7&WaQ֫4/ֺaZ.yLWޏ2Ur"T{~ߕU\)+5%r;Cn$g?ƗGq7_AG*kSϞ713R)~?F3k (Ajwy2H߆Fdٴc~?ƾT֧w='~ͿF|1hO$g?ƾT֧w='q g'2oDg??ƾH+Tdٷφ?/2/) t@_AG*'dٿ;Lc??Ədٿφ^?ƾkSϟ?f#~4 _ Kq7_@QG)F3hSgTQ.'Ͽ?߆?F5k*(pe/߆_ 99ݟ?*F3i  9~}2Do??Ɲ 9(KV| 8 g#~5^}'ݞ:ۣ?oQb?Ƥ]sTQ%ݑ..?H9Ci?g$~5tRpsg$~4w{a|"/{sϸs˹-+έm?zo2|5~}se_?G|5?z?ᔿg?#5|| 9*yQ.vx2Dw_?Ɠ_u?_@QGpϟg_#4+~ΟG|5#k )s˸e;_u;^E.ywg߳ ?ᕿg_#5s˸s˻>Vk 9(]K>SxkӇ:O5S}_oyQ!,e?H9_z*ܞyw<}Kg$~/{{Ia>._H|9zk~_xq(݇<>(?G<3iʿ }EG<'ݟ?*~G|5#io_?ƾ>}Qxg 8񯠨]'ݟ>(?F1ig/  9^}| 8߆'2Do??ƾywi>>{Rg 8H߆} E}| 9Os7_AQG)F3hSgTQ.'Ͽ#~4e/߆} E}| ?g?#~5s˸{Iy2Do??Əe?g  9=Gn7G2PS~ДQ.'ETQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@KZd=[▏8ewwV^r8B9۽hi4'D?֑æ r[DohsV~ <7: 34X|/ $;⫛KW^8~ϰ(h>5~_J;-L}67^IQ*.'ﵭ{^ Ojz<><^MAt`7XzT:x W yýcO2ͬ\K夂99샂#|w7²M7u1u&)2H*$ݽ?9BQկ쨮 g!5xǚhӣ q; Ĝ*"Yk&ixx܇84n>f7zg8d,1R%'߁(NjxEhScWt.4RIfʒG 9ff`(,oVjMh:/Mϳv3||e?it뛘^s4D*$lʛ؀OzE6]6*JI^r__''ї q77{_i,L *SrD|wd ߕ)Kͯs*(1 +O[㷌g!xJ֗Yg I_k~!9Mz#R*]I$$k8M6;~U#k7^3Xm{hW2FxgPHʌ+د㯌?hؖ/,vmN٢p#q橌ԦI7݆٩ \QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEbڭ6˫{]!gɅ ¿?y›[[W;vDP(r&Pɵ~1hOT8]6/xaG\3'RZW;U6Kd,ͷK<o+9nac~mC?jm{O5CVRĖkx7#\ Ax)|w|4iUޓ}~mZKiP~Y&R08֟|?tx_W<^y̷cJ6-TF;a,u٪ٗ aE_x x}s#w0HBy $՘Կv7Z*񔒺z[>7մ|QbxGnS.'5%]\}X4A<=1_u=~ ?7y*v"ʮNlcھO;|I,~Z9m/Vփu7#Q OHKq,SdprA#τHu+^ẚݠg fHL9+{8FZOXW^lbKZy2f].N? WVT*SUk]A|gHj_犿iO"tF`h}I'jЌGٯV˽FH{;[R @&u9|F\u(Xzeu;1LɴqrqyN ^x[o=$XjspESp1.̓E{rM~*kFi?}w?b/اV/=Z֟ףPVGi]0}pC :Y^-jF7[/D$`C~eߊ?fW¾JmS U`(Dv(WQyh٫vcjVwgF xV 9a*:pUk;Ciox?/iY¡f4}gE:Nf2^JwWoW%>*4 tAq }7P ]BLd%o^} Ki`\%$ʧt.݅xᾡ~~(5xXr./,Vby SNMd){j_L7ڏ=6 fO*ǿ:;57*y#Wů ^4> xGG1.~c%w$f7 xտg_iWޛsh&I [LW;^ibUh-I\mI# l4y+76m4uq6̊ /?C,v>YB~W%B4Fr?wm~_?{:BCԵ4y^C&)بzppsZOcx>ԭ4_Ynl_,$mɃbk(Vm ӌTdՓ~L_ǯ?h~ |ZAOLYf7cA+BT6uT[s>w]oT$G.pp\뮾 C;?o'~&xo>~L2cZ-;P=Zx~п~%xJR[hFTMjD™rvPHTPOl1x~~ĚV^ˆPnx {9q[w':Z'i8د?W x_|;}]^{ɡ p|!L ЊwoO\~ e?z|M_ܮ[M1ݴ >fe֚Ox'7Csi\Ml` gE}PF I&l޹qxWX/234CqxYU$a%Q^[%n'CvWZe 7Ś ^Yc$۾fE*> hf/ׂi^Я#^K>'eXu\6sx;ĭsN]-gO7F63*)u mp s3v~¿^"p\I5c \,`br HÀq՟Kis8vZ${Oo٫#6+cıX>5ir5o5q(}KyQ4sgSoF.NŊ+oߴgx©d 4wtk s@|qyqggPh mhӗt>W+]~ Ԧ$QEs"B(QE.J*0g_C?~= P5bq""N=tW"+j^lr챠Xɯ9Kx6Nh~M㯆o.u-f5o,/,g]c |#|Pwޕe&r>d\4Znۤ [o3(әr([iZLRpCmQ^=㇌>< xPkAY黶Mf1ۦ<gtWΚO8J2kQE +7|c=1?Y1XLglq'~ޞ '_ W~$|%_\-ímius! W lŸl© K}MNN{h}E~tUs"yQEs#0(E򰢊(DRG2/E/cŸI~,|B6x'J7Wvd * #z ԹF9Tn>ʢ!տi/>?~o/GWi_'1kD2vgəZdYIX+vz;2欟~\=]߱Vn߇z%爬cu죓PLTU'nVIŠ(BaEUsQEQEQEQEQERUV1#(.>1?c&W<t<(?jIݳ zq^n;_Kxy/į:/&Ӡ9KcA+ 999ydKK&֝S֧RO]^h7ĭ. g~#^x10$o4y;$ns2qКnßEº֛CVn| k]h\Hͅ BܩH࿈AG¾1K5J:O-;}N$I"8-f`-C=o؇/d߇ ouoi7kpklH,D8`F eK$K.Y=w^iXoDe ྃ <5 ;Þ$, rI!pҹvn߇:w|A?-WT#h^2ޮ<1X .N>k !ek|Ix!mZ-G.DA++ʲ 0g߇?<;xF[@VMHcH m$t FMJ+?Ui>mwEgcK %g_۪SROko$%KT  nU v&'o #{='Őh7,l8ݴOh6/|O506 R̠1_Q/k:ރ#^:ޮwuVdv`o\+?>84>:xNͧ^x_K(Ky$q\ί:Jvgen_g|m\}\[t+W6K;,nQָI?|<4v*2nZ6DܪwzWg?_xY:ږJY`BQEm+0lH^'_߼Tqw iYz*fDgwO[io?Ciٿ_ax _Яu=bـ-3G^N0TR0@Ε7? _ JG|5txo zK1/7),lW#O%o"< [2Wxl!no,p;s9~ f_xO&jxz2̪ʱ(ѹ ɫ~x77OOּAuwTYLycnn&oS_o+'ܷς~(x_Wß&_NmCZAu#/]zkռ؟X?~.x]ë;X ګ E(¤ۑ@HTrO].ݽR]⏉ mk~? $^ZxM> Եrbғ;ߺ ,2ذNt_1 @GW-i!?471Hu )1#6a⯂:L:žMkZό DfG"~~ SƟ$|#_B0AouT́T$)?a?(Ծj^!ψ_\湷ҰfV->](xcn|U~|^<'|I'ƞ[;ƺ&zĐYdXϯ2sii{Zz[d۽^Nϊ9D~?~>fzÉnZ73݈s/~\˫x_? eCBVJ*A\~1^o=Ů^xVmgĞ*g%~٩^Ĩw F@? | nƑuxiS} ^(1 fސc7 Qt .gվ?᧏?ŭI$ZE)xPo"@8܆2y短} ljwᛏxCլ 2YK<@aӂ8cz"19JkR??P_دM?5SG5GuCswu*[^7. `𽎪։bJ0w'v2A .>_/SEx'\?a@ +D 'ٴӵܷwWgy*]/½Sė2#jɎ<<'on5ѴjB|=~I|K/ \.a,/̯ T//k@WZ)k c FB rG͸߃ EZo/~M]!B;W_~ǟ|U)|kQ SMI%7k)s|kue{HF<.+/C?xVd|_+I;o <1٤ofEc$QzI؟/#?{ yK6r[ c,J.H?{j%1xgVկ5@W -yGRU$d?;wGW|M't|GkbTxv"~Z wyOw*ymğ o>6?gڒ7-M &+g5bQDTQdrkFڛ {|%moOg.EWi+g @~/?~ֿ|+yiu_AsP0l ddhj *4 jzC3ll-nz⛧=VwKɯ*5_Gmw߃\च$מ,Lkwm%A;~fs]o$It(҄4)/>b߄>+nu>˩[%R5yI;?I="Uh,efIj`c3gQ'g0.4sV[5A0pꪪ ()?Gůz^_u{KXmDIXBns7fgoVB)rj~Pៈ4_&O_⯋5+]+{IѦp*evw_\IuHneK-)_;k|ExWyk'Rdo~x~*nH.]r5o^?e_K584x]YV6>Z"* tW O8I<'lum2.A.a _O~!xsΙkݬ? 5{ZcQq&ܤ($&Þ>wgc a:__<⯇ͦѸYLycryk^[KOQ 7C^=| mh.5MV?i~DXB﹝߿=p1ک7Vy]SXԦ񗈥51]G(i ,EN7oV8)%i:\&K /. 1ę-CBPPmWU$wgsтcs7?ڋ>2ֱ>5[-}6kBd21j,:˻g+_ Dž~%#T̖Wpa "yS=#"q__3oO?/=?4kO\YfU(#h-8sM.Wv>gվx\j:F5-a,[~l|k z]kNl=*Bs48) 8ÿ#{M^oxMy61*Æ!w; ?߰/ßG>1M;/Yđ\ kZF g v)+Uh6~Շ3/[+.u߳Ot;>[kĐ<88$$:O An x>IRKSjw2ed~^dį|MxM_vƖ^ nmf}SFOw(=ֿg_O~5x!|EhznyĽk/?|e ywȞ?VZY7vbP$$|obo:MY4ƠxdidHC`g5\].IzhIYiwwd/O~ |P?vecj:\o2DXPNH'''Io~<|^i?9<+|R:]sXmq$»U_8N"M{k?|A?_&oy۸@8#?&x%!$o3 D}ܝCc=~|?^ \^iz<ʪo\+?߰_TzNJ~t o|1u'+s%tվlqӔ$gI#bNwdΔ2T웆X~ IËs5ơw)n&Eu/ʠT?h^~ of׊cykOjZJѩIbe+!xQ=WOoxڶ?G! @!ܣ+&XW#q son%1Irɫ|h#g~6Ջêi^N:v`/0#< }<>_op|}]Cdž&n\{bNpp䜯5ïO4uyZc1_^jS`Vp(UmQg5 a? $ 5;8'Gu +VBB* U+_Vm9v:_ǎ|Q<+\]xNVxl0ůx/O1ëٳ /? |Ij K#~>/,QlxsHGә/ܫ,)x{Wj2OxW}oUX"w$m-o(Ѽ8 Ξ.!i<+y3(siYkJzkS2Ծ?/+NvԼ'\x;<cJaMq.~Ʋ~3x(~Oux9<?gA5rK z|)> |w7׊(xG^fE|?5ߋ'5ƙk~#y@Y2TII8 m{uA?9#}q$IY{NK~?g|c~8>V״E:LiPYS| x/h:_/e-h.YvrH{Sgǃt?\k:>8?Bb+H C~6c_?oz_¿SmGOiլE$ZGqT2;,>i,FV+}[Y Xk;ƹ$}@ c# ^S;_BuoVT>Yjs>F##?tf~qևk^G~#XX%fԮI9kE4w]k*NekGkOcQ?q|MxOmmtVtd#u`ؕ8$W>մǨjp.5{\Nʣqv ckޫ7Q^I#Ǩ: *Š(((((((QUM+;ς> Yu4"Ғ!dxr5:r.Ukx oK_kn /TR_|Vvhc b'_ko|E R9,ubRz197/_4tfm1o!@7O?h:]NSIlᇔN|Y^xT[xm.xWj_u[K]-SL %7,a#hHy*---OW#_ 6o^VU@|.I _ſ/Hg'Kشic ffLX*p+h?o4!3[lEn3'v6n{W?MŮao iO2(˺Ew(HqT|A-ž/6QtniQ9&0,xu7Ꭱsq4)mrNXWqoO3ǟQĤh7~(k[$ER}fpqW2jkv M3\ݎڶ{g{g2 l2R9W~\h/ 'ú,MHd 7|[M?d/5 ۭ*\ 丛_,JG8Tg5뭾gܔW߷Oɫk8 :W[\^O~5?}65M]Eߵy~i2?3iLn}qSG\e8G3.l3xu-]b _/'"37(2bߴGE|;q $ңԯ mU4+x,#T̐bˁ9;'E+v+mWݚ='%ÛMWI!}$2R R !OOOM·`$kC⎣#'|QɿKy1^p+'/b}KoU_|K'_uώ"H+WM:M.,jk>Q$0l7߁~W x%.{ ~7a69+hjz-=Oi kzoiԵmZVf8UO"'sm~:4k$rj[&7IB1a:Ý7|imj~,TOIb4is 2K ~_4^^m~= m[sΊukA->a y5 @bY BT??mnρ2o~~."ij2| c>_9AlTWo7?dh`x[91q2Fq_vZmu[yX[-r3(`#MI8:Rk._!QuIgix>u[IcMo4C!UFr?n߱2xGZ W}WehTMĄn$׉_Po>I-@Z2_;[G4,U"ߎZmB}:<}kV>l/5J-89 $rM|;<'\x~<}vU(` ChFY@Qֹӟ;1x Mgn'%"̤80+7Qko_߁;eCOK4sv:Ƌ[jM =,7ʺ:H~?i_ ߆*oZ&j {Ο9#0n8bwM_~RG~g6|cxwAVkXqgjh`3{'>$|NOsi#jHZA,?1'BXAZO>8oؿO ] jMF6ɤQ", Y#0nyE;U~Q__+㗀;_ UM3B޿ie `'`[%{䏱>3x_Oo.4/EMʠ'&ӌ #O%Ҝd{E| ;ßؿC_]#iɺs[1> GUdhm࠿~>> >^RKu7_Ldu\;kf䴵j+_s?g[Yf;4I3˓qQ=2+mkdo|j^[=.4\_kŵD.6ޥHQRI;o3xLxS ud7ݿfAߚX+vƲH~=Ա_/෇ǚ:dJ(۹smKzT[EJۻ?#enMy_?U(~&~-w}W;j6mWk[儲J$ɐR)%Mf UxG}/Jzo+X gSW_Ti;ooc+=s!Mq൱zII|'%7">px?lkŸ ,-[_e--x@JDA S狓Щ.}%լ7uw3V+u\>Vm;Ugdqg~>U^|h㯆4W|tkR[$ 8ev0Ǵҟ7*Q8tO]Zs0ܰ=q־s?i 'qcRO x^!#82m8> Op/}K .~էYIi#xgUQ,l6R>\3V[?- :nO/Z Ծ& W^K&85C+Km2X +;ۋ[xOdGw^+ZIƉ4{ ZT ]_ Gv|?m#A] hZf0l]ݷ&TRkEtnWmSPm?R8\l5iw 58[Nf,`GvEzMm|1x_.-Zbm$c4{H/`Nn[wvb]Z}%wQIs̑,Fr*~??5XkZ94CFn}:dJ9{GgnO?f[z֞u z_5+Ɩ0̸f5VEo#-ƞ fY_ZO4{Ƴ5Npz`+?~ڿ u;xQ]1HťVP*8h'>^_wWڪ[ѐF~[>B 5 n_|5g^X~iq{PÕն^,dLTwk|xy+yclr$n2Q)վ ( ((QE( ( ( ( ( ( ( ( ( j/ xxƟuu㛏Ii ~Ǻ$atȯJ+KkOe>k_el E]CZ}4P[dK5E%.099ʛ?Wк+EAQM fnPLQHQو ?Co]I8(o}Sn2+?^*A_?nwy6۶t(i]_sL*QoMz1K~:o*Z7]j &uLapIs8ǭs4K4Sk2/l'eUXIת*M$G{2[C?隆 #>Jլ#weyC=nрe`r# ?ĞmS=cE+MpxJ~#n$U6EY[b9b ~YI] G(5go's V|hu 'úNv`RkO[_>'_|5{v;[c|W֍α4@-"ϝç<~ޭ k _q]d'ND)Z+ַFSrus{(oox/w^.fK6ۼU~NvI1a|FΣxoş'/|I7綱B$#I$CdyUESw{Xu |?|o٧Ǐ?h֞SZ,*ćʸvDdBn[r֏t [LI! uWmE 6+R?¿Пo߳/']\kWxSNG5dCN 'rw ?g]cjƧ}Žj~e/ ۘImB'S%$mv iVz [T^Iy@GY f¦ђ UU_ '.L𽵿_&9m֝mBBlR@8#RZy~Uud?΋y?n7[;е"Y#pD2|2=+ߌ&kC] .S&SE;?5xXо#Ap߆.liI3"a(1J@O xvğ> |Hށ2MWĺJh¨ пwi YM3)8},`ׅuko V_:݌QWg“JGS:&~x=_·a\}S=[dzt@8dQt֞7^IV"JOMrI>G#?*u<1ma xu]H#CRb8Z?>1|Z?ko _xkT׼} e]eXJCxmC |WQߎ~4|m_\KTiO H.,p5>66:&^_>geej:֗xkY'家|D@ S%Ex㖗 x'Z߆Q -uK -#$XgUR@$dZo5[I]s?'?MsUyi.XgO|RovZic~;9.`3Cޓgx;T[9-n T}J*$s:Rg'> N.|GxVIc\[M )Ak'ׂ>/j|y㇂uÚo*{9KJ" dvj(f[+|12Z> x;ž8m_[V o* |%u㋿Z[J8?@ w.c4\~#|h~ gz=,|#bmź*ylU ('& /:6Q=O[WVYC1t*v^+hխy63 ?L~eנ2\E6+u2H]r;W}~0ྟ Hw>/~kO ]&4M} o2ֿ?5֡oC|gi~"N+;kɸlҪ*$M}̧nV=[_oxk!o&Oj$- Dn< VWs+Oy7t_|Fφ u h1iw22`]!7WVTVNMkhMz64o h/77o"_5$" 2~.~׮)~Ϳ]oxZž[Cib"P䌱Q 4fwi$~:gwī -İ'^7,BY䐘 n[p>|cgT>| CZ.˫64wb4Ъo.~bc~QG~b&\wU_;_ࢾ$O?Ǐ7Z$ WVNrbU /|$ax_~/cU"x+⌾$Z%pc1(H})9G4N~_[z+mmcOş0~7O χx{u C^ҦRtڰZ۔L<'8k~-1fo 4{DUmic$ia n;\RRO9bkmBYm2(Eu7y3iQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEǒ8 7S wq}k ^K}7R|qy= 7Kv:)SU'{h~,<ʏ" ָ-#Y?WCYٮ>( 8w:ƭ%/$fNXݎWͿ??h/_xڧ[@NJ@ [C68A]_ Ӻ~VzQ)J&g)Pu-iˎx [?O ׯ$u yu3ng.''ֿ8~ +_T:Եi?/Xne5ߐ.d  x5tJ\GX%.fݭeM #$Y齀#Bo'(Y1x]Nkİēwq\xW:_-cZjH"d%% T#%ۻ .<%o^~u[3H>O2o8ꤚw6m&?f'՜Z5lj|=g5, q cV ۻ:Wg~sk?ߎˣ/5¯ wXIH^fG0*&ߓIBk𿎼ix K1'JMO }k/cnqPϋt{}#Xi7:MPed6|  )I.-n B^|f?Mwc|y [ZsΏw^>^2Nw|^_ߊ~2ŧxZnG`ba$ !$ ~[/?d;Iuψ/{ZG_N }cԉ@s_Hx6?_>:֦OwS3\NkY@crZJ=YVG{K"N+g3x w^W5]pLsGq#([m gֳv4N=_;_O yFyxn5~U],|r=M}0+#L}.5ė2[⫫05+oxI#NWɉ|xo?j ~:|t,Yg  G /'7lK<2sj?XD0ѲyNE|JWSM^-Kymw?>c]MG_. oh1\LW*p0C2r{?߳ß?G/UռU&\}Ye|Hn%WC{99UKMV 1#hEiH.g2ư KƏ,GT?o!&_4*^FPA'9]?Gw|eE"& Rb[W 0_Mk3߉fGgIc$eX}k{7xWl~2xPmK,w֪#SƮQT|x9!K຿ |'^AnnK=QI 7;%릭|Ҹ,'?w Q=$_Geun{S5fFlce>?_ßOˏƄZƩ6&%Ż4:31͔ i[MS].M,}%,W_GxR^7ZWb7r쫂ۺcz'>;[~ߞ߆'_| $: 6E~.K'Iy?ğ57kѴF "--X`.A6Gg/KK=66D0ƂuUbSS}N7ѿOC&E#t?4ڣ{;ׁeq6zɳtm<q @5 7wma]|Vngf?|;/i_ i"|@5 y_ųoݱǯاƏZOZ\iK[/ LmmCs#KydTh˜c"QWG_˪:ҏd_8F9{~m]%e_P]?I? b jz^r-4^h33<ʟ;FTŕgh>|1ú]@ZSn|x6ٙe ת  ~߱m'cGgݦݺمxdGUV~忈_&{k~?YtUn^UIY[{y!W`ՙn>?3_׿ io6Vh7pkxn!Ad'2mmYv8S/{ǯ2tۧ(LG 7)xUk.>RQnɧ~tOnؙDknv33kfNuн()hQHv((((((((((((((((((_Wc^jz]1)#7sc>TRq2~ӟ ,Z>&0hZF҉k Kqk/_8 ;G;%| VSRv&Ԃ#P3 vwE6zhZ|~ A:-C:6ޝwA,W a+"0A\^ko3|־u-}.][#)8euVq#*%TZ#㿇?2Ro5hShwZske2xpH=r? ~R<#ωkyo]x "i4u{,~?a u}kM5⿺1UJ<)} uO?d!M׈?_-x]Uc4˞8k#/ H%A[QRū[/mWs_??Լa|A^Cs0?s v/7éΡ7{Lpr܈p>=Z*S!{YwO>lW?_:ygwMmy3ڌG汈>g+(Kⷀ> ~ {xoKa-Q4 8J_j[}?~^TV)Y;gx%ƚKweuapmnC&WA +~r$xoV~++%5x^5h1Qvl_dQS&#T>G-6Oz{9U/"7o2 iPWpo|'&xĞINGoYvq cV**}_N߆)W}6>Us|cG/R<lmiznP/"7 H3qZḌwɼ7WߔUr5mRV|;G.-z>񭥿N_7wBQՔ/;O0k{Y?ѯz5[ɰ$2ȌBƊI'*Tbjl|> 6 l4-nYkHQ ٢!U鎕xIax/u֧1ͦCp♋1J, 8!5tU8'U$Wf e:ڽΥ jxෙa#R#ּg!gū_xoZK04_f};L2"fP]s}ELbO^ޫ|s;Mc WmĚ5"'6WlB~PHٷQҿ ,k"x/? |M^[z~ݯ&UU Uu@ұ xG zx+Ѽ:~v \VіN~1w|qu# ,a?|z~>.#dIe2 r1|w'~^^|fмqcር㱱n"[HMD^@#J:mmhSw'V[v2Zk-գL" 8k~&~ʾ"u ^εc04:,6s3QJ TsվF>~tj?#)~4?(@~4OkZVD <`KgrFo+wںA|HӼy1gEYd3I3*4kF­EGIӦWcIN/2|p/_|MCſ5vu+Y㼎UTAm #j+ &7WԾpu+<XXVeI Efߥ42qVto◊uhju4Qy #l,Z5²;X:?k||~ kOycimvഄH"6KlRkp ħ-W75]tv&8rik8t?ׄ~gmrro/$7;v,pϽ7%eٸ$/O|4%[ݹ#s+i:_1YFI+3ۋ;?jOWP|mᇑ]NYJ-42PVdG$ dygo{Eqᅴ]O,x$s3[[Q]F. yo+8Ҋ7[v^X>۵Ƒ4+cn>jwj(cy:(Q@Š((((((((((((((((((((((((((((((((((((((((()h ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (WW߁~7lF]/¾2\ `']?|_qZ#4}DGm,gbȮ !a1CgJbmzum.ɲ/%\+=p ;OMso篙|5W'״40`P `}1r 8ZyUAG:r2sC%E2I]"e#>pEXI+v=hEx?|J›{zNQ}f,؋~eHTE9$ 9ϏO{┖>4ehӦZI&'u۸Qm썕)Mnϣh9gF;czgxTy29]վ[I51xfWUx9v3src_-Ye 8PH(Y3i'Q̃誶WqI%7QmvPOoukyiqa@>fV| JV$l'5M>8MHuw$T_Ycאj36z`^9jͨ=W] “)ur) [^I S+lpK^<3|f4!-42$"0Hv ԩ]"l{O ?/?.C{4.P"\lbC08zMNMRMT` <)/#YєZ] *^Yƺm6̀G]*/M0?cj|Ē~~D#!< w5\ڙrɭ U4ԭLҀF.sЁA![Xo /]>E´TUXﬦ!I \(-G u?=AX}[‘+'zu#K.nTVZP7z彏!W_>`$@,yVnkA|z*Egkiae?V(ysp = s>][Il;K\+=p  *ז0=01Q(V('_Omy~=v8] UtjV0Y\(ǨXͨ5W]@)p?h.Q_<7?n߉4]ཌྷxKPnh%E\>ƃ kݤմuMZCtHK ~z|IJ+̧ * k;_:+XAY/k/ڋسX^.-&)i"w$=;b5}!)#J+G-u wwWw le䁚ҏP嶚hoD$V2: ս(eh!q' #e՞Vy *TNHS)(T\+_㮡B~&jj얷 *m`}}+;]WKԭ/%% W }tpi Sd8`ifaFYݶܓҨkif{xL`ApFyϵ3呡EW."8&"g5l$Op% [i+O2IיQ_6_Ǐ>zq֛Wz#_^fpyM|.QLH&E'PVW,tV\L*nd~z=x $kɿ)m}3:8+4͵^MλcVZ۲6fϒD1o<ڥM;8I$zs^EykӬƸgSmu>qpx6v.QY1$jƒynr+t}_=r^AFAў .KRZyk 6Eģ1D**(((((((}㇅~$( ;>ŅYڳ;RKXa=G.gO;qRCˏ:փzY hyGP0"Rƞ2oi~$[uD*ő]p,9%g&5/A#Kݾ+,$U{cqƜt]Rm[[Yy q GE5oy.eP̷4FpVcOO٧U-߄uޟE?[콡_R[~)u(6m.$B8|i&ߚs^xNIo߇O{Mx5Mj~'}'A֑hB8,d|Io hu;l4i?h:݂pg{ 5 kþ$džM@L2T Z;sz~?~ݪ 2̎,F@΀぀v%n4sfiEmú?d?xh垗pm#nLj|H''q#=pGUᯆ~෾?_P<%v,Υ-6 Dn0X;P7s@>,|7^swgxV/׭aT%&QAp *~~gjZjy3^ވr@@'$b{jߪ{//V{qk+o>2hz*J:sV^ .!*݇=q]ß|Կbzf^Ɩ&c { 9ֿP~xG5 8?yF/0ŷ;e?? ?j|d~2;I>td osDi˛o,E'{įc's+]/;xHr&a½/( 552/߅ˋ#kN\]1LK+ඡ 1YxWt?m>tJI8_,11~p;qp,qHvUS#reaZqmmc# {Ui5K ~JԠ-5-0y< 0PN>vȮVp|gO?>2xov>DŽ5Hmۓs"sflIY7>>$|XQRKlɯ1 B/xMt_}muojc5j06W8 gKMoSm蝭gW_ $x?ᕳk_M5t]ZKXI<0G7UFw~߄|u&-xo_[4/'J;i]UvSwS̭&Nψ^m,ֱܵ{o/,y#>PݵU5῎> ~3~jc']']2,qGÓ \vF~l|rn:9ܓ6g[M}Af~`eMW9?(< Ms#Oj' 6>$jP.ZTa4ۻ%i-1sLe~~ #>4bkl<`U*rM7I}ԖݿCkAo o8x~Mm!?O *^G 1<>zoxR_u5kǶuėfy +j1_b8//iz%8u)4]]THU[Pw|(T< L_8bS-:ݧhj zBT`p9'Li4ʕzi+th?ڋWa|K񧉗^MCQeJ7*X ($(x'B຾2SQ X nP%wHĖ9}O>>(׿Nn>m& 6qWoC|:tJe)es{*>l^ג?t}OO-k37 [¾&Zޣ3jq r221*3"mr@5-ouv?C[gR_}o Eo~|y'ӵ?;#y#O4;dqiܕ/燐Ʒ&5NԲJ'?Q%}_ 1kOXu>k!IJk` s_ g9hq͆bs`g=D+J#.TYX]ú$o| +u9ћSC;p|/>N:U *O9~=_jڥ5QxcŸڳYclN79qS'IkGP4(#fnwe;Ⱦ05]Ǟ"uŗ1 GÚY=ھpV 7` 8䢒W#8M|ΟZguχ~ ºɝ2$WUqWxkwvSZOq$Dk‘%`Fs_ui1>wAAc?ki1W3H@qσ[+5 ]}mŷjFi+k?}/C;Od422Y6ǐ m rs_?V.㔻wZ-Ԛ㭹1cq~Ǿkṭ|;1g=x?_ !kx IA.E#]*eNwvE}b/~|oi оO/ Ss0$gcQ_ u)ĹH#EO~ďR◉EFl5WSe޺t99fP2~~8@Y ^V6kfo]U$\mlG=0y<eψt=cO7Ӫ Pb)IQۏ?g6ߝwk Wʭ}vLCǟ5Maxߋ!-g|I@kWo|j?u@SR:m3_CqfKp07UyT8Y C iý> hKK}A"Is}kcƟ<}|%׿ëuֶ4)1sTd]_,=;+hXtw% _I~<񦳩|jV6,oB )P#?7Gˏ׏ j_^5[=$1${~_`o]Ծ!kZ军qvng喿,:S9+䏝TWpO$^g}=.gWOY+%h%⋫*M>{|=Ri~*WU!#z/V 5|AOYYo%69/lO<~|`~ hςXYF(0aA]"q͓1 W}Ktj}r+e1*(rKL^c+ G; [{o|ffmk ZnЮ.m#͑ ϵxo|/#Tl?w,<63X_X~\۩~:-";c|A|I><3=4p&s0_q+jO~7w?~G?JoW~/l/|dFŇMxDd0/8`S kÿ)ῇ~7G٬0m'`O>} h'xTֶ:zQח80p&/ΝhR[mt׈x_K.=k_sh-$doR oP{װ|rEwV4j+ӯ-%@Hو*N2?GOྒྷ![òju+e742SLrk~?Z_7['44ױiwx.0@4*rZNl֦zyf 6"WjA~NuIG^rB;o5ߐI88ZN~ſ}}SV6%& bxrk٣;~˿|eK;ok^.-m.RWդ!l 99JUARR\Ͼ8ٯAAI_^?}K8BUWr,AY2s7_Z~s66s5hf$!~l5/?&w[tgCk+!L;d nNd??2u=. ONmn#{h7*_aGQ|7#tub C]"e6k|Qgk/lχK ƒw -֗NI,E5}gge>>ٯC]⏊Z[ݷ<gIt;iug;/_ 0PG:f(7o o@Цm;)3.K8gz_eMLJ> Yj6֊4[Dk[l$d9<s?𕞳;NbVihevĒO$'NO IRQF=O/i7Ğ!>)K[GwZEv$H`y _mkwM7O es&_Wkƾ] k?˿ tǺM0x~uM s'&?f6h5)7jߘ{xI+ft~f|㟃<|-Kkt3A{mmƠ]<2+j Zs^rk[D_)k_MwZ5I]vVid}&\xme%q>t|3'ZUvv|vNqeZ96K?٧ů,i|;sGվ"j.|ձH쉉Tq02|]++|5/ x?L~~ vsȲ\I% ;|@Ė:Ԏ"A=gdc??<eiڮ-Ŵ6~s ^čݳMktoE>kVO'I:_4gKt?Mo;/CqZi컣fW ȻFvxx  UN4\kHJ8#pG߂|;}5no&`I 8`+5~ſ~;|a_xɼGc=Z\[kX;w$#pڤfjU!;^G ࿁bؿ~Y4T\xPqzydrzu(!zso֧ COKBCwo Gg%r3_{xQ'oCxnM/z3#mn[I]6l,Iɬ=7]~}[vBw1=r}b!ʷM|~鿳[Tw_+O]éJ٧v-V$z`b_^?߳gGIhn-|Ui5nN'N1ҏ|Sĭ|s;&hnlXd^U$sA߁?&SZs@"{H@D9mXdAIsVLhzfßcn_xU. Rk-RK{H/9팪p( 5OPf3h.|(*5ӻ<ϧ-юE' 'CWg߇h?M [ $FF`ć{W%ώ~?:׌7kЕZPiQDiٙ02SޙQI)kw5c>&?೚.oῃdrе&efE>Ⱦ_ < 4^Vlh!f!"Yd+G `+${uVUeAEUQ@Q@Q@Q@Q@QR_>#xSk߶W ω4\, ESE6;>)$5G#3_|GM7VZ5džLx/u +HG '+>Ծ<~-~WO{⧚5 7y䞔*}-oT}[jއ#b^_ޗ|'i/"|nX [q~om>&Z9>$xKm- ²JHTUsҺ^ Z _3hׇL|;2NچH,0H'5*o?:7}?M kYKĖrGYĞ#&տ2Y4C].[4iOTWύ?loo.~4/$o{e~_{$?!|kJF+Ip F yR/kQt?F~(~ٚ۷}WOŔWWzݔ:zmHrNrF2:-j8j+:ƃ&Ui$+Ley_I8=W*;i?D}\u/hwq:\؛m  :#>޿<+ ߳~:vz_XYY3MlБ$J|QAoZ/>OZKP-$߆#4"+wQ_4_O߅qkHM]IͷxOʭ+*2\s^I_?;{/i]xPش`@Hr1Ԍo^*V}]dƍI+HZ~_kMxuI#mEub2RYZ?n]u%oi|hWMvLt hU#oV>ZY|Q_B8\~*YϨO#0T@O,@5=kv:zuFX_~ulfWsxn!ģ̆#$7DfGnRo_1>$x\ڪGb"M#+"PńlFp@i]74Fto&/ xgC_4"k}cU۔F~kq~v#5:tf7ZC9VH6 ˻o5>%|3׿h_د\x_qZTC.>d,\PW#]PGCUg?g'$hznKq$,D 9LWq?Z~&:fe̎𸌖 mPI 6_v>ڪzv5w +kDqƣ1rk_ߵ/~~7|KSFmSDkCCu+nh*p'8Ϯ~K__&^S*εJіwz u ɺ)G VU^5k;Rug z6-~/jo uO~},*YHn2Z1lz/[K~ Sໟ2'TH6B<`09 DH+uoOoΎ&muK3`.S?v=ZUwu/7|ya7}r RU|8㯡V@Iz_f?!͖KE5X"7 *cQ[ݴv4xi]Iz֏j6I$'8*gO/o/jоOh>Э7:v(8$M}'/G޹fo^5 P7-Ɏ7<rp@4-p8W|c/t?mīѡo5t+gpI.)Fޫ 8*q|Υt_sMGSt"K[PSnX\ NZ ZEqo"\[ȁ7 AE~I|}-h ŏI|#iL%-Wn \ ^>"=;qxF߁ 팖/2<)lRr+4}ch宛Y6rywq[]$nݑT*_#xɿi3g'7m^jϣj۷[kx!8. WM|soOu{7Y#;H9 ZyoK%'˪_\%>XIɆ_*k8ϻhls_|B,uMcXwdP~E~¯/K|X[vw$be3pK^lvTumޭTpn5TWnyu4tZ;y'x^Wե uwtʒHCUI>+y>/6i{/O؁3Ӓ*R)|{zoJY ZOլﯬI$W8=@*wx_k|2,eҚN[-%b~?%"|B5׊;} Rt>(DO!kWSH`Uc{>4J Wӵk/=Vq+ybқpqZ_[wCG5#3l*3lTc}Lj(ۻڭϫOmuwcڊ?K7>#^m|.52\تGwm x}i?7_9dӼs J$[ɚ4Ǚ$ Mԍםߢ9m[o~Q_.c1dg+P#/Xu4Tdm>~Zo~ڔ[~^{kW?nm ¾ ׆%;%#aqDFzKm~՞(7k1Y2 ’>VQ#wѫ i~gZn5y +[V8@\nKφu 44y>IS&Rqs?2ߎ?G_)7>| DWγ.$o+qu$^ 9t|1֭xt]VV}PUHٳIʊ5ku^C87+#}(GƏsxfO5x%hَqڼ?۷To|HqeCMQFn3y^Camc=g(^]/T*6ͫr_<xa'|#yKr_->ʣ1 C7ǎlkow|oBڢޥը`fA[8`pF(E9(V1(p(((((*Xٿ|sό_1}?MԵlܶV"@_|ur;|CԼ1}g_f,`[JdC)*+5NޒgW/oM#_ĺχmѲ8O8}{o#cVG{d5mP(W(BruV>:퍣et?/׌iwޯq/X,^'̷X->8/ž$:g<{ae9ih#O?29 O 9ƃuxfO,lFf^qƬ|~asoǣT"l59~κG6Bg6ŵߊw4Xſ7?|-猿ho2!+^B>2}-9 ie={7ƞ=߉!imŅ?DrI.Unb_TU{5o̗nNt]-?'|7eI~ȿw ?RuDpwࣞm"i,Zuo~ }bsnc$!usj(q*WO/Cg¿>-j ~?59/u׿~EHU|d b>¡~w(`*W\޹DzާGۨU؄ qտ:QՒ6iG%+6h5-"O ?B@_^ho)xkzӧ}"Un$1 Ěb3n8߇:qO~ao/{ǟwC^ wli f;GX>%|fWwQx=1݆aXʡvI XmkRt|=IxzO\43A",nS9+:r]J^*4[KX6/~ן t~vZ entr#X_.P*~xg2~>>;6w> k(l`_hVхkZw?)~>-> jbФ}o6uhʌjN5'~ Ԯ#K%E!+ۯyazWe>.cM[{;s VxZA`4x +9A8_|/h(tږCw;cH%̑A ?v PG?tQQ얚J7ӭ ??iTO?nw1y, t) \^MZx/_VW,u@K #1_}QVmJxmt_?/~~=;πuMCI?_RfU^q-3ؼ/7 ۲k|AݮG;l2=PJ(٦_{2mwm}/%1kڗ.4[/AƺXك?x"> 9m⇉>$:e>ƽQ/pЖ7< J*]&t鲰}f]Z魝?-~迴Vk?h|:mi.;ﵘ6յ@ܩ8U^"fh پ*G獾 x}GƓQo"F8|>\K8wd(4ަZm?ukoh~)=e _7mUE9C+>,xOiwv>j2I?jIz +Co{!WEKdk[u%g'vU}˽?i(?> 7e+}[S[BTک)VzW?|`Gbh|#WOXYYI }\B7qi^99b cT'%}Y~f'zG_sq֟Nf](*2K~a_ni?\>."h> Xl17uAS}?~nkAR_ʲN *'+0嶷w*XJ.6I4ӹ?>;4ۭSA/[-͍YT;qӥ\Cs~?z|g⺒!{!I#kԨ-fs\7GhE,ⷅ%$oë[-Q-1SoI.܁/[Ə~>oV>]xZx15oiEWkC2n*7m~Q\r(oʖt?|/:j7[υ7?5Guxn (ܥE:m"N]#ʀCuNj:r |\[xP} .lɽov qV`Nå~QT_$AY-V?0/}<#"hO[Zd?uxb 3>\𿌿f=OwMSS?w DP$EKUPÆ0?**]5&oiݾ33ZF,ӵ[/wm2c_:{⯉_O xN;pz3x6-Y|]}ص9dT!q#n~QCo?Xno)|']x n8xwO_j"[XC7f@Uر]0A 7 ǟ HZ[ ͭy_݉ UBwj&l[?Z.> _'Kmm,0Mx!a1^W?,i<'ûCƲ^iV-cAjT{-0Hr۷|S3 ſįxPԼY0ž=ab%yhN 'uxWw׵Ş,tNs7l~vG%A=q^(P,9Q)=mGo_|p?1Oo:5-gǚܛx1!Hcg99 d׵|D5|3|^=Cⷃ|E ]`eRUQ08#J(Tm·+?Pφl6hCZ ɕX d|̟&.k?n/|/c?=ռ=;]C<rr1jo _W?4[x.$Q6lz|ǧ_> 8o~Ͽ0x~Y5RۋIʗ zz((?_ Q][M4d~T4O~\6T%tCY%;1.6OJO'ƵԼh|;{oϢ|'a^o//#CxQ'ZҔ#u_{J#RRCK_oah(|C>~ZIJ7dI&#82AlsGÝ{vi|` /\Dȸ<|轱xx^ HKKخKeG Mu8cP);Ii~@2Li!^>'ɿ;l~o??V?ڛig8Y5-7JV[i۶SIe+ +~˨x"\}^r ^ ڑrR3nV+<%|Hվ AZk.Ю#my"ym񓃕jѵorIl%t/OkRN u2ę= fi tiZ柪LV I~'|tv?3cR`}\xTV;.dm# 4d*G>/EP~Ӟ{[o'V=d2E#B$aKmٌ㊥R}?U?`?"_cwfslV~ __!>$g,Zx@/lݻ_w~~ϺM,IIˆiZ!GUcRӺ/hS_43zoVq\0C#(R Nӊr]oEm {(lg!`{X'V' ~*H71#j7%?ޓ5k^J{%cit}BqQ5":#"/Cu%ƽ[59譓c|9oNH/졨jB_kA4G?িg.j>&xv=z[+_1 %GHф'j%q(N]cJjskizִ{M*Zly72ܢ&zmbpsRMiơmoysN$9o¿[kW@+=WTּ7ᯍO5+\5~K.w8:W'[K~6:P^,0\+r@7*Bx88/ikyM#OFg$Mi LѪ'_7՟?|O;$msVKαS>j<ß/۷5-?^&Emuymݔy5 qxXxf5ZT6m{1%qlp8){G=;6Cx)o{]vGh`_PR!"YJˎ3:k6bɮLIfwt~SzkjO#<;ռz5+Gӣ㍎>?/y-ƿ_ރH|Lu;ߌRx|O'%[+fRPW¡WBKq:y&oOVsƂܟ[z~S~3i# tRipIvߴ*H]pBE5˯ho`ڨm]3ݜsҿ$ ms76FJȶ;X}:G~xTq$g^ hÂc֧Y(&߫6W]Lk^ӵ55;O`9z|AmrvZ"Y|IEqUEoN+oW~|R7kچYiu۟xughc#|Ugʻ]hFq^g7=\mMC֏mo;*Si`})eh~g}sRG #Z~!x į]ٴ;.Vhs+ =2s_CMCyB:-xLmfkF;Wva;sNE6כ_7xuʵ&xm{C_.͊p,y?s9_)ڿ~;}Et"GPHF+jg _|1~~Z>x.7>9Kƒ'5 Pr(;W ~{iwp*w\Z׎?ࢿ~ Z.ⲒSWNے8Q~ߴm/<#c/÷-hIuh._Bq_U#PۂO=Ьwi5 k+ۡ%-zdQῆ~~z_5GFKܫ+d?rXX󶗪OCf쬯? =6xy~oHPihnoFdvmrxz״?RZ\i'?JԚH-H_ŀ"|oo^>?|X7h,̑Ʌa2Yay*{hơ[[_[\\xT}>5V^-n֬na|=q_?4^+?`? H-G?%#L2$Ez xGC\']GOc⿅7$vY˻ G2jWnҸdӥ~qFK;xmPRX9\D0 Iu층>MSyOfmêyF '8h%jm:IaGn* vR_þg ~|;ƶ>&OwkxfY^Ky_9 F:m$T+n; qvvJqq7SGooY\*($֩Gդլ؍ti玵~^xwXu[M?k[ğ?` ú~-|}C䥦^"NZ6qJ+?ۍSL{5m*ϢdݺW{o/HkO[JtWB̞8@`2g__|s Io~|ᗀ'*[_}%do m/ _+͸8¹?t?~/M=jiRI|waT Xǜ߽x_~ x6 %q|86tnWj7>x~{O45&OEsm*Ư4rqU Sz_d[5pZٶxð\M6E 3Ѫb[Iux:ˍ0a$څW-Ҽ_~G.ozƣK$|fLYDG rHj}}Xxm%t^Ю5ҡ֬&ԁ!#Fc;RƓj fo.wκƇuF'h>GXI2}wj < o։&5S rM:NCnvOU}[.UgfWQ#PG~k~$y;Td%uO>E״KP3G7rR&d !_y>xTX}gWkYK1ؿ:]!~Қ'<G5|;%i.neyR8Gjo$N.嶶K'ٯ|j׾_xOզHFܴ2:=sWi]oV:C2mv$x|#ox nGm\\!WdcQ]׃ ?O)x<[xV76>!@orr걨$$.4U=ir7ݾ_և֭i5 kXMҬ-w 1"gc2kNj [R0t|Mn BwyIY02 *ު+?mj_J_־i?χaf$GP]Ьƾ_V~߲_O|?_ htxoX`#Rn đ H댪J2}__4)AM_O VB¶:ڝ?q-ݵr4o b7S'#E].mU-s WhK(9P=į|[-pMG\~~dΈ谢3)|9{F'XOt:e>7ė u,d3oG T)KM4nM?jWXԼ9}uJR(G$7+$K S̤gڼ3wgŭCfY<79a΍nm<؈oGMvݟj|O M|%Yj6z,%ۂ31%rNp@_#:%krhfo.{Pu̺ok@:=α6kj k4T}PM&ZjBe{kQbA㗈> xOx~zûrxX<_jrY $hW-o,+steuJX 0H8޽TmjOo}Q'o![ϵ>4v9'%D !?_?e?'^mvi׺}1yN)A_FV-׉<;e?÷gߣ5=isr ce81YӲ{>u>OOo4kۺ&!a{ec̙=A2ுo?k/ַ_XhϤ-}, } dUr/k ԛK|q~ c{;@@,{F5Qnu&U*N)I9?ÿ ]~%iZB,DA^qx?g~h>,n4ۋo<{#>Yq~sS_PQB]:@J{xl 1QA@ɿ {~Ԛ/z: ,+ͮa/*"0_UǞk<3hȷ:3#YKQrf)ԩǭof߱EE4et}ۼ'w|/:/Q i":#+7.sN#_Y麕SKK:#eX{jW,S_)Tm3߀uW^_muO><\߱Ye |N? ޸5.f`ZN }IEZiF>z뾿w_Yk_PV"?.l8/g\}+m`َu5QEgoJ1+ 6>W^8?-Ǐq4ocK"w2@"|{*JßM񟉵q\3ԟuW3~|5=7K.a7 deUUXlE~\O$xņuYxfTOӤh;"^9cYΜt6;^~Go7O6s{cī?]lM#d6p{ރn+S߀|=෇8ú%Gs1Ezc}Mu[Iuq4vIdpK<sTtmsEռ=X\Wu\C& S#1Iԓw<~u[kύ5oIconLַp^PA (\\Dk> dܞW˳]9)c{3>*a-zT59t:o=ږv}H#-cKF=URJx҇NJU__R| &>>?#dA]_wvO^ 1Nx5 |V[Hn$'-#Fu9=ko^Ύ5k*.+ uoRGѠ;[Y[iI}wAЏާ e*U}Cٯ.|#E^Cw;[+׎;Wwu2pMt|+V:#h8>G٘*bZ*#fͭL篚oL~?a']Bv\'7ܚ}_CNDghVQ #n9x(F -64{^+=.`bLNz?o>=izMeP݄bHr=O(匝g1Yك߉~6\Tf5N?4c @+ݵM/N<3hŌ:l׶'RPjrǗ icy} YcR]y#l1\o7[Ěo~mjM{ ſ9Bf9cwjYj?>4U?ߊ|yKmt]ZIc_%X0o&dg! J1vok>/[׾ uOijjnpn#c00#@# φN [Qoi4Pf+w ʄ Ѯ3㶗Ŗ>Ԭ펆xa*Q S^ U*8]rA$RƲU! bQ񗎯5y\t=Z[;]bSIe8Z(U6뿲=wcƗR]CN䉖X9ff I? +-nOx29cХ(ĸ߽WQUʴָ>Yv|aNTZf1&$cs^o{V~¼>uW3_07c8%U4[KPK[XZ[8XAfcJ1])TkV,ƿ^Z ocbOGZ#|jv~u R]xīfcu`y1$pv L{k^H,$NѱW`Evrd;TjΝו?ᆪpqXaTҝE}QE@QEQEQEQEQEQEQEQEU-k8[ā%A83/#Xx㦭KxoMxT]Hc[ϴ,KێڿGɯ{oğW SA_ q4>9ƚ0 &S7yN~SLcKsU}-n*A tskref~?ٟk)-²Bg7;0H XkS?|7ɫڧo-4(qgPdN98'.T.ZkE'jyM[3?. #ÑjuTw/ 2rzXתjP{?f?tm[4}P2؛snL){Ջ{'?c/ٿ ͥџ#մ(jfVm'86pGО27ĿZeS|7xrܴyEJCnT}Gm=4;l릃 h྿ }/ w5O1"`F9PI5uCIi־hz__ '-/+P3B y٣_G獾;Y-~fG]#QfdMl ՟_SG_<7?&-ΆYίP,FZAC]z5JN:O>Lk_G-|1e7R+6Hcx6 Srx~>;ݚ]_]m, bQm }?3'|?:u.n%7-w<1p]PFIS]۷ZS[١M|~|'K?/񥿇W ڤ㚏)ÿ\~$ڴڳ0Gu޼O#W|Mx^Mq" n/nxσ7K|I%7_ 3g˽,X[jmX~ X$DYQ[;|S$ nJ*hSԤwwmt4_ůmoƟޗ+KF[K;,b_2"Ii oFN:Ol>\[PЮ4[L wPNӁw?'E>2uX5)"'{/ @'5Qm?G'aRi$XR ˀi8$Ru{mn?f۷6~Ozx^ ~.tPfenTFx݌|7,-Sg. |'7ޞ4'|+y~~4}NRm,#25)%;|3|zooL_~ |_cv2O:WpU;wk{~s4{==<[ Y{sy;H=3kO}/^ޭ{CQd&x$Tm'ھY5?YƟ"~nj]Ķ[sJ1C30e- gTһ7!*srY;/>W|T7ٿ.OxN9Wwwŧ[YbG;W<$pk)~^ [į|)Ůkr¶y2!Ԍ=~2~< uώ^ ԑ_E>!jL G1wnە<9Wy3#7|u[jBrd Y{~i6#3chY+}/e0/uKHhl$ c"k4?hjOx Zwb|HEu&8 |@~WM{xf@}Ɲ/)o웧||qI7-A%}w%q|tA)|@7O~-H絴*˘K&3.;Ni'QZ}쪰6r=W/| Ι=K]jWsA3u̼_S|H^*hH2,;7m#__W~"}~ب5aJۈ zW[qIk2HLr)\]꭯~pxL_u1a&n#tY $ X9$Wkԟ |Ijz\8m.bG*m#G/VO }Y %׃/g(a]MbTܹQ~yG_Ə :׍>8xf}o Fin)]Y۰gTzmͭ=[z5R$<]a3=]+^SY/_[?;oi=ۤV~P?cPfwƿ?$oxķzZ;A(?iMK/a-OT.j$K$eYB/01W}5Nx''g_:'=['­C aHpB/uƚoMю)i#fV^JUсzwz+Ï}:w6'b #_~>([vn?ޖ4}YoUw60tJUWANZ)/'yTM5N{t"1k6yww_Mc[ gy@18~(I[iZжr<ljiʞk9?f~%D>9xGWnomg?|=";phF 𭟂u dhZ#M#"+3ɂܒO>6Wq-/g]8n+gi>2[xGZg۟|."%|Eߴҡ8ޥZu-s}sC(>i*=5à;o%)&k+Ⳮ"d[6`߉d'%U+v~=Mҳ]*=77wxzE֥MޏZ$jB> ߶d?~ sXv˪ei³gs|\r#pqf=g.6^!A 1 3A8jC<?׈<Yue7{!HO"^T}o]J:=9ړG ?:L?8_y\:*AVzƞ,Ky=/VV [#q|~?D{'-gxW4Qg@@QTO$W9[V~|1ws} VzƬ+Y9UQ۲K/@z֋mզI^ܷz1Ia|hWǏx_gv:}ŧ*22!s]\wúu}O/CPЙ#edwSj|d M~1|dπc㷁])W{7 ňFѷ7 jxOy+r$ DxMc.yEOuu SioeKnڛ7¿&?>|3}'Ğm=+O#.|He!S G{9}[.(wC ֱ |"?ld͟ľ/k,Z[I&Ց ެRK^5G>?/o>#֧vRLoP@U]Nt߃ Crh1k> dlRK#*0Xvs^ 8|b߀qjhV?ExRoBtxvk7gU a>F w_'oZ׊Yѭ,nSxhD2EطᎭo|@y %c*w:Ƙ\L.chQYXxn }WXBMC"͸H׵uOKpqWZVxEo|@?s_ ZndFh)*\`y\?/ow|[tk=FvNc`F)9`Ou_b~ I_ /_u+[kY'Fk/kZ|_x7Z,/]㛍y/]y\2ŐPJRVv{:6{~DZ׎ԼF5CP+ ۘZFcR@POkl,5݌[iM~WA SC¶NQt_ɫ$OrĢ]wKiS5iw1EE+tM7ٮ¿Ekgע%a[u; BTN^xOQK^׼!:2JȻey pvz+_ %Cu, 5=Dh "bX,v7VQ0J?xEn?] 6);4Cn'i^qzs8v޽mkf#B--/|Q>&x;UcGhhR|%Vzw@d#/\~ߴ'*i:fZƭ24SP~V#ۿg},O-fI#-cT4Me<Ź&Cpʮm Ğ5l]ᮗx^5e78-;^ZVI+F'bv[oʧ<zƩĨ/vej)[nDnݜ01ZVٻ?{&K_Ŭ@gy>)|7^!Ƶ-|B4B1 r+o?;o ^k y[;^ǻ٧7OAshdž>*^v%\ wW>ƞ DŽm< uon\h6ZY4d)JAnI=sӠeՅ%mv3?_+~'UោO3:QmӸ"?1 ru{?aLl>szg$W|K}G$6.UcU-*0.[Z[~?/mƧǣY"ѩ~c)G}]zTBZe}|?ÿ ? u*<hnb21ŠZBX w׭|z_iup@`͆C@##?gO}6M#ྙgNn|]f$Xs#qs3ZsW1E{O?њ+g&kg7Z?rΨa#XPp6/ࠟ#aߍQ~έc5\~>S?$q_۞$C΅2!'#K1) xNi~,"il4Y(%ֹo爵-EO2QK{x#=ɯ?4u?g?^6oEӾڏBc@YvI[6c/+ɿmb- eooÐF.ݹ<Z]vGR>e}t?XKN4 =[GtV{K9hn#atu%YH _>$~aÿ|DC$wzi^)hyL{t#cplnxi>.x~.Uj/5m TKKY]C fIG"ԅ~qII+>|3cž"/V#}i8T#Og$rG5sC" $FXb?i/O'.xLSXgVZD;ѭD|Пho  :HæI#&"I#sa 5[{i~ԧWi->ݢ5nj Aߏp^c[ƖѦ7xN9#$:7E>1Y&|W&x[TmUfrUY^hxu>YN ^mU m'ýs߉>>*mcE8$Uu,J9WS$dgÿ_Xc:oZa<".X"zs>ºůýg_Kh_ ֱbgϗE(R[tj8TN[{"Wv[}\Nk$v7ewRE6+ @zߋo(~|'^0&4tUD*=ViaFK85?MڋSfr4֭w,gMT "snP[k_ۯ+j_g?Ěoýzk--`g$s205.Oi=G~;|,,Y~sP9nexy4noc%\? mMSR' ?9Knu gbx!nHw :'$ ?fO隧>{G[i]iXg wQ,ѳ c!D$K)}B_ I4Vg|Nοz lB:eNe6F731g"o >3x_~O|do=V |ۉ<?BGڟ?hx6/t??>GJmoozwz˩~&xↃחĚ]3o*BfuGt Ys޻ Cxÿ5ٟƿ4O ͫxKK/|&$]PsY4uTFzoG.q6SnI;+A+N;Q"~vNe߅.֊wV5ksO;WԾ.D.ybdn0_[OcωijZ@vIH [|;ETm4ۛ{gi$v!M 0?Wkş٧ '?|$d|GDث`e#rvhSvwW4xy 뵬~_>#i'ρtOoy_]~րJoៃfkFlu_q%ȣK $ 3cw`һz?F𽞷_.$ Eȥ g_3 |5V&rvyG+*-5cE.x}~Z~Q\Ou{D]o׈l4;.찊Xi&+F;y%W?ZO[(ֆ6 1+\AB ­&[vANYǯ~Q_uV|=bY$ݦجATbT"#a:ʺk_jkO4V5F8S=9ɵO>nj=_]OFui.bҬXQ4 ~ L(oo =Y|G-sjksi}g 9P,^5֡P|hOMmJ}SpyJY霖 G 3UkV3tdd}_~3O[_p̐}r#mE+1$P-o[;Vh%NVD`X{A&3y /6@=\r"b2@8eJBִ/(_~G|WY '04c;vrqU{}JJ cŸ('Ǐچac l͍!0c}-OukF^Cj[Y*'$rjڇ6_b59^~&?uZ猴/h-w ̱&eRQPrBwCռg-'X4 U,[ieܲY 8GdzUi"ރonrB$ayAB kK~"o Zw,_I8ZJv[OU=Uͥ6>q' ;Wx_^υc|UAyZ$Դ=N+fuI2Sg"߲ "֡R_KʶcӅ6[fQ\fPd)#?Wgῂ_,ɥqSi+=;A/S7"VxohSկR HUP e޸σ4'5i-F#MnHss־?d_ߵGƟw^VKPK%a<vF!oqbN*r-B;M[Ϻ#M⧄|oEl2%8ZF)tR`QEt^)| |AoiccR5(#*clh-?gᯀbH6G%٤w%vOe!Jȣ?k? GxHt- ly7eB'}W.[Uw &hweZh~x?'zux{vro.pVh]pHMKRt_ơm66q{{y: HIEU1I8^cO8΃n|?ɥ>̋i~xYgyIC!qT׳~ݑ_$^f'gAoW@~yIiFЖ*NnUV}V i4 B<mZ](PvUmi9V_>-|+yY@_]fmt'@vED,o߈_;ھ IG\;GMr8nEߪ;\?CB0P QӔcoh3r+%wAUx_\I/gWumpI#,2[K>:_hOv:[=&K)50&{m0dI]-9i~WnD[|rBwHf!bTm,T=FK[&#aFE?ښ+?IuXMkI?Ҳ6Jڻ +;yQRPQEQEQEQEQEQEQEQEQEQEQE/+'?৿o/uo RC$*؉~Yef ~=9d߳+k ~&xñW]ܟmrvru #}y]${k DQK~ xվ xeOmko"o;ADsQ?B֮_yE#I v>cf9譔9~|{u5Ooo ?k ӼEkW{K_q ,.\Abe naC4/ ƿS(tԗ/`X_mnc?|$fg߉v~oh WՄ,eKo',9 G=kg/ Ϥx:džVYo43,nXlzW\ޥ 5m49}>BABT9mq_TT_R߃?|UgÿޡOKtX5T!_p<*|0,aA$W~>7^~>(/[+43:z ,M ?uBO{WvZ&'~/x|7[k>=K4}nMZ~VIx/iÞAɸX/W˞3?ߌQEt__mGO4XSp`w^iϕwX?cW¯_<3Y|+@xw<umgLͻ|}BR&?!iß+x^2{_%)c]ؗ~QSՕ[̛j~[r":Z^m~Q[뜱!Tq9;o>);͏sĚ.ᗓcמ,n$⸺1y[Df+!w?>k`3$qPV9%E#qϽ}ESO~^۟eԼd|Vǧ?'RGEsxK"Pr|U\ڟ]/NqajiFVnf7[|qsG^, fi.b l}}{դ{Y;(pGռ:Ư*W>"QlE *Ǧ ^|?wfx幂CPYy@8*motו xΥ-ߡY{wƑC_ %x[Js\F` àl4m'O ]/'HhۭgU 2oO;? *O4[9ihfQ!X!|"#rQ R7_צ4ΜZ]u?)aWi]s?&),u#n#8_L~۟U-D75]E#z#27k *;05{y{Oit?$/~_kٟ/v>u.Mb?JAƛto !x_O;-:{6֡qh.Z5eVb+4},R9g9T{6K_Jx^@o|;o>!x|9$ό4{ȑ[ mip~FXVnG=;^ #u9msoX xV='Er[i$3w 69g33_?a/ vv~:g =lVO r"K2E-OjVnɴ&:".Ѷn~3@|.%h*}BFݤȷqD9dS 0@ij*|W_r7_,5 x,VQE}5h cѶA6vmumZzOʬ{7g}zGO> Ų5ώt}r 湒d㔼-(C42SsGJlkgtE2AѴJ9MM18Ǖ-u6_>%~> ᾏi fbR+ 2NNqҼ /axß%Nvf[StKvqRr4nW+\>ZMT- \՞%YUnen?RBm\oIӿ{6buTl^g!d2ySV8_? mozĝSQ4 '{Z("9IXBQSR<ӽV]Zֿ:#PRM=kx#'?iouOվX\b}!y&R6dbȯF5|)Ieoovу,qHm"+u e\ETiOkKs:zn6m=w?u3Xս8bȎX`r8 ǂ'}ckh?p꺬6q?v$`[S ?g~c/\xOMM/Xyw{eI+ 9`g˜tgM{~ |;scxGɇ̑A"3"0괽Ocow~j拡fmkZ,4}K{vƧ4B}I'^GoIUk+P%pZ6 l!~*j_~1O6:ǂFiCvC$ve1`}o a墱N|k'9fÙ=;j~Z>jF'Ğ(xG:?G"KqL 9qƽoxWíxo4TW|'5%O; Ux%՜?jMVhW}~S VT5m'[ǟ K]ҮSö(^ nWϹHf"R91 ڵw_s?nxw^M[M)ܢwu 22W i0?@~ξΛi=.&o3 H IP+ 'O Gm=E}>E-Mi6Ua판Ār1WSQ xB;Y|T>!V$+R9KݥѵuӥYOG>(ǎ.Xh]v~_x_ltO^ӴVK;+ԊkAhшf 9$k5oi4е-LZKojTd$W*wE~4|HwN? Pox~xruHw#;"צ)??Z3_'>I{᯵J6aۆIc RVm/SM7coCx:Pz^6}[5,,"F>Y$a`Z3GýsƒxsEuFYd쵻yf%riz|3+O? "]0[u{Y \~:{o˿º՞qIխ^J[=F);RDl9 1Bm^̻ԧ^_m+^oo~ꗂmf?I4fA{$`a*Emo]U}7Z韽ZOx^O7|?{u=f e\3# PogIżHSѕW1 ௅ioN?xg42[G\X+ >ԯ/?\]}O-YLX^xNZʜe?ޗ2~jz}6NZ1Ii4 !sI vf]B9/"D%p;~IX_qǃ~.^#xVլɤim\Fd1&_3jpOc^7ğ ~,h/ !#Ѹ9"j [[[nZZϸ_AD/S'9O>m}G7u_[gΡ>!]`ΗVaPVzuZC1c~ nKaїQ'io M=0U3W3Vh~^!ӥ; $rP+OkV~g |'FSFK`Y꾵TuoҌ^?X>|fwx7zVE{:j:,fA ϱO<@ϥz> xj6-&+-s 1P@W5í?b&gox7tmC]m/KY#G$S2aA'#8 rx' ?PxO|7./E$-*erzm{|qZ뙽ݏ׋o#TOmBSIt*p"W8u]|biG9Ӯ+so46E!aܚ Csl45P.cwʅ7mU#$X~/<1~Гxn(\ͫmxl$r)}hnK[_V_Q{4cCI0ú=kЗiռQ8}#O#ΡYM'yM7^:o/4{_yyv;3Ŷ(Pӵi%֤+H${?.~_9V|݀\sf,<9d~H{e<;i←F<ݺ^=B_~Oag_<(|dww~ ~&+\x&S%GB5"?ezk˟I,rY*I鶴s 7,y'D|tMo oO8yT~ PP:LJ<3RM^}\eF*6wwIh?'~?Ηl𵶻fh\\̌7>9 pdY<1GM^AWYPҭf\+%b2CaOYk6XkR|qcTthaK5V%7.F{Q_MolbhG{Z7YGn%KlXƼc}eG['/7#P xjO좺]HSX AԼe| uO~4Ěkx1AK*W H g_7y/^,߉ҖYtmI@d~NAeQM[eҠE6޽C~f5;MSCqH1rq\O6~Z{MKm~ iD$/#ce??^CR#.]-\MoG?r@S鎵WUYO~gS~{T0a |c,:dG9[ge籢7+3 >2Z9(6#!Yf$=h:gvvžG,n@"o:|Giq߀ u3^%{A0T`-iK s=緢~'5~(αqCL&4V|`|NuŖ.n<+c> YFL`k㇎?ᖿoڛG䳵=Sñą|Iof=?L\ͮ|;<]WĝkMcv!E0%USU}v}}Y-o?]K|5Oe co5(}w9[мExz=_:-%ܢ^闱:J;į?30ooxSE6WFYy;pA>P7fٞo»I .aa&(l͝dݯRV4Kz_?#^'<4 75?2F|a$N:j-Sw{\jVO7 ~R$n:?@ 7P7ƫeX^]=YZ"py?.~M8&A|⿴}SԳh~P$ Ll.G|~50Z\ҦWi$ߛGϋχ~,#Yvڄ76qNp^Eb)98gwgOxsFdkm'\Tub8|s_%Eu:Nk; G7x'KE+ c'HOs4;O:y7%$={NQ/t`fS%I~N~gQ7棪/t_Z:n%-yNE\*Yv8O ~ܟGlak H6Y aUN=N^X¦B^g|"g_oM4-YRI`K@RD N }A<5q{ L%"k&;0m꼎H5oGF~Ȓx:;iT<|G7G)|g|KI?i|P^u&WUΩ/)_rEM:Jv<:T[#CH.<;o4 n{pxkM쭡&#\jSYh7FU[t9wgx6198ޡ?> S^ӴWRruqMxêČC9 ~x7 ~ k<3=/j*\Lַ+3D+O:?୞m8O¾0mq%בr%ffdB9* +Ѿ)~˿2;߅|{;mCG,z,vsId1FLc gZj^w<'gou[oG{8-u$>YT7$'$]' ?Z<]5_JB(Qq+=Ԩȴ؞y];_>#}ma֮#A}Ė?(޼]`5~.i Sfo/n3}E.H[lWW⏂a oXcZ0GP0T?~~ԚkM%)41|zurGI瓾|>g |ng-"-ͮ^O-W,:ĻʌPy><t]]u 7ሷMFBn'&CwuE }E lW}Ϝ?'f [Տw2kiĂGvuu*CeH8~x_|;{"#X>SN1g(E?>:Z߈?<'m[%ѯhV" z#Pp7vƏ/B8im|^nۚJ)(+|#_ݟ"|=ZD㼚1L ;o\xOᾇ翖ً%EC۽UE*j1.撽~kB#'>&|9>$9*%HN#ea$r'z>GeվaN^cv<9.00Ē6t{/84z{oƞ'~h~ڽԳG.͸,ɏlNqkټ/Oσ~$FoymuHxy/nU3cV䍿7>nKq'Fo j65hgKygݎ}ov|6aF@+|h$$k[$1&xO\Տ|W6 A$"MUI]H 2%]O;??S?5noIo=쳋ɮ$Q; oe=wெ|.oýfu+;I:.s1s&H;;břV6f`$¹ <ܚǂ|SIYt{Y!xqVK|T~ɿ|e7xO/5ǡӋ%.!@?7#w?OOjÿ _ˤ1?^xM Q2csdNɯ4N߂th}'NK[H˔T*֮^ Ծ'j U_xK&ԴH5,!`Acʁr9??~) 񧉴qYub;[t,pyIKP{io`I7^ ';_E[c9w+uj$vwQp$J9$ +k'T0> vizp_VՕF lᘜM}ENk_O'ៃ~~MI}K.?2Fwfcf<ֻoh*쭭+ `ִ-{[!=$Ã_-Ik!ҩkYz W/ 'ŞqF|%eFhW3]43\ZH%-9ZR4!?:/n@G"xCx,|KuTBPzf(tlW MWR4m,+:d eN1 )BܶODf? t)XS[GnaeD!:aX M\[?"\x>M&Ӧkj9-H2@_WQUNFwc| xXgUj>)İkO͵oWëpP<}#a/AxSw_ui1,&-BX.mF`3ΊIO8}-Egq}Ui,EI[]R-0|]/ x_dcoy<čc]?ٷ뚷 kZ]%Hv; %$k(".V<ǿLM-]KX~XEʲb8ʏ߳>:,IL|?n!M^M־JlB+ ٕ'vH$׺QZr3Vo߲㯁 moo !#ZuH=1/Oឯ_xqxnm_ADQhٻhs O$׾QG,.ܯiQǖ/St>7_Om.|:n$;4[r~wr>fa^ | /|mj_jR3%%I"(Br_$OQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW¿OIτ?%c 0]ɫxV6:\ mn@6Z.ߗa-@f? n4G0麆~$mG<4a|*8nsY?h߳< /Cnt{`cx@.n q^su)z7 hֺZ曡O R(-9۸ Ö 5zoD]ifچaȵno9 x ps}Ri+h?C5KMWhN x]{ztc/on\*6$+?տcm7÷ mFT鄁e{(DTI x_^?hLڗ>"}$.mxw+=W?E3>>xx ' 0\mxG:{ɮOFVN-Z?B(~$? Ͼω*kZUxb JԨpNN0agW|Haj}mt맛LԭX ;r/Cl2 <3J\JS%KrFU3>L-zoѾ E4oϬ762in$P9V*}HPONche|.q $ww-~aYw"Kmۜ7~ڛg_zWyh^W/\B2ć%+~?n r7KIЎj@doݰn⺯_hO߷g_+l$jExfU1,hu\%A$Dv{V5^NWV> |k=OOR[ #<.˴0Jak[_|kk$m}~!)k7턠]bgv+6?|E4va6W2Z>6u|_{|gs^xֻ klfx 8K^-[U} 9՟$~>>+ҼaTԼOP<|>q9c'f=owm]^].^ި?i-c.@xGy6鷏y:wVp0D GpyayO"KOO:˫ZO0An蟱O-=CKHRH|}'{:Ho5])2 *OA{_k:O{V>eνxШVe8RWouM(#Ή_oC_7?5]hOՋknd'r=7ڣ⦩Hx_χ:W*iZ ֗6xpw!B9x ڃ kZ~&;I,cL"K g8߄?~;)zgrO1 I/&H}K2CnNikc4-]ux|uE᫏xjR}Bh>(|7H~\.Ugσ^/og z1"~kW߳M3 [Qk|L'{  fi"U *1GDŽd?3ַ"D]J[BiekQYqݭ;'?-m[S3,xǚn&xP6~S;Ҳj.OX&Yi P?d_$߃W>6x1vrr< X`3t Nwxul52kwWOVˠVãsd=Kƽgyętt=LZ7? 5Ρ/fV%gS(nM}^qO{&>XxSFSnX9e9$!'k۫L5|uÝQj#C 9dI\GĀS=zoU\E҂J\珻qjZ|K|zeץ׹FߦoGVtZ.jA,K4J8]^௉?੿ ody5gLlujUm@Nm2;劓TֿaߍGM}xS|@oò\g!>l+aKg0G[*8@> LSAt?\}[Րu6(R*'?ݮL#8(=S>O,|Z55އkDn|i{l}H¤,G p /xV?|=~1x]Դ+U6ZϬ[8⺑M %$ _7Jx׉? uMbIZ@]K= .}Ye{(i.deʧ 8ھ%ܙqemxo7[ j9[ .F f'{I-a W?GlߴWOyu_ M2CGR5!X);sԓ_Kɖ7+Pt?ؖ׼N3Ruѣwvw^U*gw+|k2kZ.!C#w$( dm-"OMRwOuZqcO ]Rj^^W']7RV(_==d_ newCŸq>e$Zg%f!GQ[A?w7>|iJ="H[;`S{r͙^vE ،p <7Og¾ ;ڗ%,y1љ99۞'Sk/ڷd}EEWBQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@q>>+q7uSmEktI$m2>ƻ +6- >o-7tֱmmi0R X %$T+ooͦx^{kyrX5U[_Rkt (((((~-~~8~!H]HՂ 8`G2~%v(SX~gˇwdRN$UEfӯSnQEhHQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEsQEQEQEQEQEQEQEsQEQEQE7*((QE@QEQEQEQEM(` ( ( ( (QEPQSp (((((((((QE( ( ( ( ( ( ('φįiѬ\^Zv=e5v49;xwK.i}UqCqZȒ@FHnGS Wo+?c-'>"|LwڽLj.a6 aXW 2qq^WOB|}m/ΈеBo6mfibf;|W ` KtNgf~Q_G/|c wLRmPTbB2:~9.;E MgX/Oh|@n8i5#-QIT;0lb^d_QJRZE~rOwmƯ &5e|GwGrbFre*_z!Gv1㩿o h^ {5}kQReT!\I 0WzzOrQ_+r~֗h_~o>#k9JD<#goǗ=Oi~9xK4 yY)#8LEmIDuקo h |Pn῎ tweMyfu Hd~*dFJr~6_ /4b_N5;d%|°H(+G.צ!=]|+>m2K7RKX'5OkC~>6'Þ$tM{[+Xyv>"ck|9 |y8mk: ͽ Ya]ܸS ~ߴ?|D[=c,1布k*$"Pl"UX}ZׯUtPY+l>I-|U3_6uٯxo:%u'UXe8p|p܂[^0iԌd]3Fs}>g5;~_f/ }^K)s,4)Vembzq>8~ҿ-k}}_%5MG3HvlB+,LO;7' w+R[Z׽TWOxOo~)x@^tZ.+0Pr;@Vki׆tiçxwA[˭F̗ڢwK 61&E5t)ak}-~Q_П?i? 0iQq|C!Ӻ*L&2';L/Ch-Z{+;9йFhNOZ!QTR{?sJ|jk⏀/ '^1öd_I!Xeʃ;?kW/iuן9mXy+ `,||liOa~Ğ*݋^zuH )FĶ _NaM6mm oٿM+?'2K=#][c o"ђP d󑁀Oӟ6744iڔ^akr.-㸋VOj"3^A՝{0,G!qx5ջ !R͞^O/>0 ^&YH$ӭI/#~:QY[ofcJxyInN'^ӵRմ[uI l28 Ey|ho'`S&&On/9ۻcڣ񗋾nsIik=񊰊5pe, _m< p𖮖ۅ<A60wlٜkG>+}^I^>*l/ڋ>? |=̚jڱD$TAQAtzl/j/X_iNV5 *H2dIumrV.+gz]:~Q_O|DCgx/it6ZcYM{י~ڿ7i 'ox=m?$kgEY)cUWTi>v'mֆ6E;TD5gwf PI'4}R\𮝬Y,g{l gPCʰt WƟ,ۚ?| NYmmn~[:lrI?6'*>xoZ'VMWG6;9>p}*c5(/J"K^iE|OOi~^N%̭331͵W1~-bPt|xM+Ll:e3.ƿ)+t1C#ﶍs߷C~͞&=3֟C+n JőSҼWqCxY>"x~[_71ZkttBY匱6}+ߢABeew`۰pFm#858Ùg>/=+|a+^w;U\,P#1q޽:ĖƲDA|S|?: 𿏕Kcgƽ#^_ cSNXmQ` -Cͪ+?hm?[Lܖ7-)N Giܡr '3 IKqX_]|_; ;G*XtVZosoI^icB㏈kQni%+}jCpn7JۘvlxrF {\> 5u4=HYӖa#*#J2.TH '/PJVIRM;~?Eoy/ⶑ]Km[vti]DxYA$zW[_Z_7k_6xOƚ'˧j0;K"Y*KFܦz0aO|Au_ k?u)o>]s 3Hx- MDҴ~ڇkmVPڠ"ֳ>yѦ8En/|9·KyZG `0ʨyvK[-N8ɦQxOlo*_ϩ-\Im l'# ՖFQxڍ%)F@6sU#JnM.>Ư,o_,_|c,zsIcs5/(qUZ/s4qOmR'Y #3Z/jw ρ]{FD),~?^0GqrWqb0q k W^0ҵ$d[;.PHǪc5>8ҹ4M)ukH9a$n >OCx'Ih ~yV" 6,{vWgAW_NΥ~xt-l[YU3+Lw|YAld'ca4ת_77ڞm#qvFOy_k[7p^ç2Djر>_&Ok">)iV:fqqNV9Wwu>[nݝJ6vbRU$sykeIyyu.iFԱ8JZ>$m'VL]/W#ʺğY5YvhbY9,:b')aܒ7xQ_%sW⧄t/jYx 2mc"8?;۰~~ͷ5ٻKv?\_٣rIi&Ɣ|pq[B|kw3AӂwQ[EPEPEPEP\@)˦d3THr>uVre*2pkt~O9 n3'_/ſ dϊpYXwe4͸y_|oSǚ巉>)xXm[*Ve;!IU2Hsrǀ0+(,N KgYxⷆ-Y}zwX#K6mѰ7e$jN7׊dC 37}Cǟ/]FUbxˀ&H"|=/׀ig6V!462?.Z/k_zn-|me`%cf͛N MV_vX4;#lG_|+wOnev bC,^%>?bo7ៀ/~|-OoqOP˒3`s)o h],?ح$;H<~f'kQ{߯b~5-zO˿č?]}xͤ^5\ɱ43BŐ(n]oٿgWOM+F4Zag|xs_TVk>wOoI> џ>>?E6?eߎZk[(/|/m5i4 J0hV`"*r\)º/ jT| 't? qxVKLuhn31U]kڊ=oޏ'K~k~-xG(<# zFk'!,/$+Bw|Y8|dޯ ╀^h=+~!8B}:5:Q%lOщcgqË=>HG,# Fzu_g/F u Oxց VAuP-,4QvR1+M6՟LjQz~!|..~ xUѦմéڠKwc1ZQlpI횻w (.J~Ϟ _j^DG5MY,fB$Wj+m_*}vvmhI+&;_7?{/υ:| s~ U8fd%d@Vl._߅f_,n :O7F7$/=l-h:/|xoZm6mcux"qFS`Oi.g1կuKa|24*yRج$.}gTq1pw|WI~5k>WWÿ~>,Cix68c%;~_LFi[}H 91O "8\ \W֍8 Q{[YW)4R)REy? P¿t[}u tLQSv]|89>i穈礣?>>>!x:o^ H'[r S$$f"H& U vN@'?q/Wξ2ֿU4p*:*' eE8ӊq?YlT~ͺڗ q[둍V?kLg pG9PFb8-EbY m #м7rmy"GgbdӁ_Ix^\/4-Κ XhL1;P N|3 {ft Mmj[<5 &Y XdH#Qpc7W⧂ƘOخ0z =J\Vw[)]?^8׾ПNg^.&ʚ{!Y>֍wy"ӗ7oٿ'_]ӵ)uucLrK擰,c.S_~|% _3kv&Y{ +M#3p:WVΔ]K3%W¿{wkW/sa:ƕki wM*nS[`@>M7ÿNǒX/i,Z9;"y*>붢PQ/OG&^SOl{' Z῏uRcuۇv.w]V-zҿd7tԥdž5-F*$o³wcY(}Z-]66޶]tq:kx7oh:OmL1ڦ7-({@+6"3/(MψE< oϧ\i'UHo0Qr@$kӑ)7Yb\Yh? {}wx>">6jJC+H"l9^}WE7+p/Oۃ3y^V1u}EK{ߐ,Lo俅߲3zƥ׾!]OXdgn@rvNgF_={G ޵Oi'mdSj+j=\^KrZ%__eŚ׉7d:E7U1ly`}+Oj7ɂHA `1,k#MFO&xJ+n|_v|#( 1/կ`nK69=i!z{G~o?av3lg(TM_wwFO=?s>"~ |{o> xo_Q|1hOV}͒i!kG|5xw4k[nec:GLW*RQ]yM-Uq~g:^[j0]dx ̠(IC|oJ߁z~ixMnDm+20A F\?`RVߵUm]ouf~`gg]*?<x_GӴk>Hunܡ̙ICNIc%㇏t/ُwjmGDue\ž,m<{gU _*(Pӥ2N!oo<5xPHltزZFJ# z狾 x\OZ?kL_B)-!#ԊzMKoDy|?)~7?fվ ;{_|/Ou]#&[3#|#;#?X#⿈4$Ot2SKRCmJ#R񕖙(5 kFm>"D q~QZTj5~~^tN?6~ğ:9½&4_sh[CgIFdv;I+ҾOǞ(~~4>uϷAأ$HvL#V|WܔQe=M__Sg ÿďxG!ޝIm5e]h,wJ`F8[+|Tտ_ /^-Z¾Qm-cB6ָ+ȑ"!$| *U(nrw_Y(|^j_ ;n+H!ptf`*Ol|<;>kmjUu/miQ['qj*wFMJN.3x7?`_v4hRYɕG̻fFǪ+coh>7X/?O'i-cJSu_]7K0\f+sN|K3jAhڴWz`@̥?x.PH;\**0qJ|~~V~|F5̖<6 yvO{W_~ޟ?h|^7ǢNU|AOs.ѭXtpI>9%Nϊ~ ~ hw8xWR>$K[ZjvZW )@*ZF9俱Gg'WhrnOLkq]%Ƌ##C̛[GZ00P2V}%;/P|_#\o|I5Ao{H']w?urǰ~5~w~/ׇSçxSC=#f677ݣN0~UV6&qh~2!'ZNHl-SP@dl~]HkO=?4 -?T\CJs4nꥈ?(c+HAFO߆u\ٷŠ(p((((((s_r~ֽsP٦xAwz'X-m r$v(7a8V[}+o'C⇎j %|;+R*_i{78ӭpRuyWk^OSm]WoGωmYFc]r[&< 'P2+7O/x>7eo+e/ _iuAȯ̟O&ÑJo< Y&?g2Hxr95x:<*FnLmF8E2G{(5{?'C|3xFn|CM_E";~Ҟ8ZFjz{3K& n?ٱd^*`^\Iut/er=x~(A?uZKݬ|\['4[(`>[N> c8ⶬ|uSzMf}n[b{#msCMKU~J%$q,GʬmB s,L~V>*S:g ˨ۼi$1X@X`Ԛ=NۦfBvi?5 ~$jז~&xgщ.m=rHT7$|t/麕[zM6=o[]ɷdjj_amk=77u-OK:IH\#?sWuWߴW|D𭿊o^Ǥ-3GddYIc\dQF ҧ&oƒOW?N-Sgt">ƹn+iK@w mr+px?HًѠhGnzM~b|=/m>/_h"d~!C%՚}i ,OH(rOZ[~*kt+MX%ly#/!2K =.hchnGm<}?PMX[-myo,;IHt_ZC~4MK<7bZYXٳ@Qo|Y|?|Ub#, 7 ꧸dߑ((d>hm/ÿ|?pK\x(u_oȖ ۱>:W*:^4Oj:+`9_<3n3z_/>4h-/u+HώVe,Ÿr:+=qkix< |>O h+jhbF5U6?c Z&.n2/$sҿ& xWu[+Ow4q~ $P\6\{}WXegO^qyu/`mno0@ |O5$RRez_,4 ?M{Z#Q1 ;p9e]?xw\Xg '-XHx8e "u/O[U'wgX~6; gߍյD`m.8VC ʑPp(|'<_Ėw 8k!sw:Oĉ5ωSXhN|mtߵKfIR@= $I4x aofw}BoM+uMF,JX 8 Bkio4xE${4[ZO+__1m;rd2}аo$c>6{ þ kkf|u0=76/2$'̺ψ/=NuyIHFB#ڸbK?_i(~ |'oū -+Ox- 7O [,HnBH Wzm-<~ih}\$dT#!WƱ૞~,xVG7^Ҧqqx7?¾, otO\sm]Ox O^0V-WPKkx/?^5!/>čKOMGtyUkweHv}τznj>*xTkK7@~h^)WLH%<ڶmtȧ\T|)]|b&mxJI-Z]Z+y7w@Y )LW[?~> 5W1{EtlfhC2BڿIyW?_^"wkO. Ed)nt Ǒ'lOe-> xev}γeс4wsT[nWwJ:ӂw87㷍.?^" u^I>Egtk{׾C m$xźG.>Ϧjj\nF88~3~ȿ O -}^0W֑吜( r|K+j޿ﯭZ G$GmZDL8wk'[tbSy}4u|%Z4ZM Ff2~GEMo-{gñx6R5MM,YZbNdsԳd<)m{k |ŻٿZXKuu2[ĥV RI Gqe~ KC񵗈|ok]ǨRcpSI= ևb^ZeSm Bn(mϵ~wbG''& u4vDt=\aXΤ٥Pg~J˩uo>_wO.MsVflL2pz3¾ ӼG--6.-_U R8=rGG HGѭ!V⫄KjWtB Ӛx7s,klnl^@o ʑSOk-ti?WI߱=g_u{~xLY}?Z!ȕ r8|.~Oe|jׄ|#Gfi-V?k:,q!gbXtHyM>/'Y,Wmg'md%\m"o^sV }GPk bMey|Xr*}'}tJUזއ￈6˸CաX[ ccZ{yO? jzEm//$T N=$n;_ogFqjuN1y$^pqs^yįZ?-^ާ>?' !i04_]j6^!{Õl4yxĭSJn5 aie nla$_5< yKx4Jz\jW=V6`Id*2 ʞ2+uƟ{GԶ?{,f1`F$=YƤ*߾l~x7¿|<~4 yAv`$ϡgχ:k?-S<ëjֺ2ZU@P`X1df)_o~ 6 Z^~Qx—c-,DJy=< ~2~_|PwBI>*-܋؅3qj*Wtkf?V{$ߣ~]PoaO4 O4keM¶7Fځ&-'C/ ~i>ǔޱ qwڿ|%O3Pɰ*,]b woyK6xh{x\<7\״ZKonnqB''V>ՏߎǯxԚH3*xl6Okʾ%v$_?m|ko"UΓ6\ű(9R@ 0ML8Tiyc:xiJ/fUvo,ipI`vG|zE_3\,'~Rݿwlc6s_Ey=C ߴEn$m{Tko;q{jjb]?GIn²J鴖r( .Auu6.QvWVD+Ww=MbmoW[{"8䕺TqKO@[Sx6za;nFH]V4h !Wc;Bz[Rm^OGm+ú=_('RGnq.X쫴I$ ^oBxAx4>hL?@vMgBpkuu{#I`ڿim?^ǭGV|/K֪5 qi(}nf,r~.׵O~Ξ umGGv@K`qWM99]5fOISNߥzQZEPEPEPEPEP^s~~xU}SZtSutzS;mϢ{WQQ|FNܧ?מׇcצޭ3.9IG븏F__t}7ǃa񅞕;ͧSawPAD<8'WUៈ񏊼MW~x~奤䰛A-=drH=m[}%<~T-n5`3p@YK/^ ~.滇J c(BA=~U[];Imligʈ%QWmШ՛*gدA7:K>QxN @Ch䷔Kǹp2+ uO/Լ ]|=KeiћHNT,x• 0ank[7/~,?,QỖuԴQ6pAU(F1K/[ Ԩ?-g߃4__|A,~_yyȍwha]wZ?oc|E-ע5؀9EUF+.RI6Ǒ_o>h~O_fmkLK˂O?Y.aتS |;}ฮ4_P]xB\K5<L4INmn6vi J1\\^? |>K\wБ+3sm~4|;)o_4{cYG+9.KljHF%RX济htr tlc \;z :ˮq_bm>vۂO3x~w_3u ,.RM~+inO" b~EE.YIO~,ßM{}A oU9VYN3^ލxýsizR67HT|$kh-:]77/ZLFB"YF獄*Fs`uFMy__~1&ֵ&yrAGoQ%4moCOiUw&[_ooh? |?Mι[Y|v> -_T]k>.w),l289V)%~*OSǼO/?Ӽ'G&OْW{%5U,׍׈n.q*is [(wsԔQhbVy/ρ?~0Nď~& ,m Z`OW`` Ȯ/ğ3ÿ &DO*.<Ifq#,ӽ}Eg*qZ*5fTb?_'Džm&-'W3ͩx$Go>fYXkeI'I~xZ|CꓪHYYLJm8, Bf瓟O]z?čjo3w);XiQ'(q:?^SGY,@P#\J7r91_ej mDXE=&I[I$9bNk*eN2Oww*uKO?o짦KM ~'}CU"XfU$]z09+|3CG> 46X~rؙ2O%qu+H"0rG=Vqkt o~!; +ZG^xܭTYI$ lK!$Nq/Kcg+Ŭ"oKmq퍤ѝFNs^EW$,[֧5x6|7g_ كXE2NY]9,ıko//-V/l rouբXmF&,U‘y>2?/=Z>j:Mk$KCL"&>9kx捷F[EROќ 7x?~'P>1ծ iQdl70$5ٓ~7f41`deBr%A (m]O+/>:>R|7jJug%J>_?Nןlyٶ*n-+}Qqk(I^v'MrtG?hKᘿa^h:\JK=s2;s\2 oWݴ~ Ǩݤ]%P%ʯ x {foh7 ti8^qa})5xk"t_mp qv2:zq%o^}ɯ.wXvA6<8$}k> x ,eH3egL\uWMG<7?|?(/RM hU(lWÿ^XXuy4H<,x#{׫RJFUm駥־! 7ּ|3$m{ph DCh|E|,3;TJ2YT\#eI0>UY7k][4=ĞԼ? .Zo D 2H0A>:F]^ Z [s?e2RĈrǚIS*z[iX>)|5U'-shYdA$  ~;FOG1ɦ[Zpv933i 3w&(PNKu&W??Ǎ<K|I2KyB%To#$9cU$ +g:ݯ|! ÝimOFw f !Hu1+ب䍭oNF<~_{TI+T1o66 JW FpjŸ5WL2 D3J&.qM{5J)?0>yԿdٿXթ|D>0쐹IO+w%<(|j>*iX*}/ (,ݲZZVk4 .M )(y~s:__:/A|jik;SVyejJƣ*u'/ㆫc|RoxT˷s-к;$JI&Ҋ9bTRz?߆S|+cےga71%s݋zUY?'c-tus2[Ic\ֽ Ət |B$atB#SaOpSq`Y}z]yëO@P;1W.G[/ SLQKt) 'a8;IԈ$+"Sei&<$_x_5 rUdMIDy 8يe;o?`Rš׍as-014r g9e~_l 5x+&&JX I5RprktLԄ#Ok;o>]w>>[n$.{uH*c #ĩ' ,x q.r \lTk`ǽoj76zJYj̕Zn;>gdsXn51 "J\m`n]iv~yI ͞&]kkx]K7Q4eDl! 9Ftyn'ٿfeF(j'TG g&v(=k+i߂b|/PII,.N$9۹@8=W%mΊ1NO +ۃņ^iƛq:^S^e^+ ![g x%oD~Rk/>NUcx&g` v#I$Iټk~O«_x7z \iOޤ,vpjqW? l/ -ox9Y?**;P&O^{=u&tc?d"3l|r]Wz>skQ$R v_7_7~e}&kq1%2ŻnBkӼ(Q|?aм?SVOpdFr`^BoCuz_I:g wT[o,'V]RV~?c-n޾V_?kZ/A'/15#via"Egg swc~_qU#?ċ/)5"m2W~On2Nmddu#/;J֍VwkؿWI־(^%խúwXOMᔞgcg|v ~ xD&xlgLklNKtt_3|D3:ޕi]'$$q|Y?i (_/x?π(XB_]!ʋm,@-G7ݥouku;K}D~:'M[KǺR fB g^ )~|+{P<X\K5ëB*8L~ gT| I 뢶)4G#]Jr@J|\7e |97mWo~1Xlԥ% =rZ^~|X>?Xx¾>:_xmujzҍKQUHv C`#rp8h΋x/Ru'5+23$$*O_~>hP=tϠbx:[|RAe ~Wُ?>0~s)cx~o>=&H7&LX01s[;^|qQ c㯈$o}??K}4Xʺƛܯq(bRh&ô)l`_[|dH|BcuΕk95cpof1V(rhU-|7VODukI)I 9$5|Xh-' M'o%m]:XgMē\Hw(uJҟc('M[W4b/[@&Q"Hf/yzmnuIB\E^}df+g~0~1[Ygz|ٴߴ&~֛¾[6A,eO<ðxvOVOZ{v;[@خ1O~Ͽ>{}7GkkУnv8Z|?6 B~?Wkm|̡}&m?g-8F=;'C?B~QB.^}rMsAA<.dFGC8Ɨx𮐺F$'v`CWk{}ƫ]> >}&F%Kf*Q;9>u~'Ÿo|uo×ks*GA%F~;5v/b㭵kok/ڣz|rO?Z ;x<;y+j"нf*P ~k[⇉8fɩi:%!h㌲PA##E~O3~9Y'[C}BOb.LK")LjNA? ~*zy*MW{S+4{m{~_i&c$h fm.]ۀH{ڻm ~(_ :^?\8,K"t YƏ$?~q'g,M%뼐K??UʘՉA+>ԿgOiTk_ˢ_^yʎ"xEr ɫoOةtOmucd|?P|'Ҽ8$ڎ<VՆЪ$qɨuڿ? |m/_> "VVY2WvIeH>ҟh߅|9>_z%7ڂ`N*3ƫ ,jO?jg7:𯄼ž$mJmrntag]Wiw.?䕯omߥͯGci=oEΗ@c+k7C⦭ை[-Ym]\pdN y ޫS[|`/'Ccg.XWk/J sz}<{w+k>Voéyz* IbTfNC}_ʒgm4(π~^^xj{3KIff,Lɝ$tK|1G࿂|R^"HYKX՘Ĩy,+̾6~>46]v#q͎$l8"d+BY_?ebxW$i?xӇ(8T`!r78K&hw{[O,ߴx :`_.Q:}/PYg -beR$F5韴Ə4/:\S.Cbu; ^ h? '91|#Hll~ Y|TӞ}&+6cdqoCa~^$cxnEIio,zY%n6ro4 M{o$|O@__ Z$[^ Q! >n=kҼkx.5[O ,+9</ӯ|j xOzg/"MĶYPFT3Þ>7|_'Þs G’pM]킈 ]B\ܹ4|{&jg&OXlOڻß +Axa,V+6/;m78 A w"KıaӾ=bO0g _ =x~:OT-yt4Jo{w {/~ j>׭|QN1c*ЎEifKu3UXگV&o"/Í}eUn0qwEbH(_Y~ gwZNJ:xI:xFwq#Vf2YIeX??. i|n~1zW6g <hOM4W6Χ1ʳ]*ArrASXIѫusՃyZ5_yOwG|W KPЮo@#DveY{i_|Vs-s>6x-ź%Uf+i ]O`~*xgF|rFh|?/`BvcbI.|\^ѣ[|=0*fMIª.x$ӄ[knlNQ_KﭯG+'x7G|DKxRM;e<9 eTQlO&bmSglK-Z7[@X98=+z/muD^ӵŻ4hcQZ. %@oۋ/>6?u=a|MwO ۮȮTVvs.E_{;*>fw~ SR~$# i[8O&;>_pX I_h/Wo?g5O4G)xym1,s!^Tt5O߲?|?uZĒK}mo`Rs&65|y+>l7fdpVw ~lbמ|֧EKD}_~*#¾"[{MZk@dJ?kOkÿ~>c'_c]I&ddU1;nV߰)8,t3ekO/+6ZZ.kgVi7mBDm ׹|p3di6W^ߤgtI2a.IJOv&ڲj/^8?:k\|?_omIqNUv@#~6V*]2ds\Mw`7c5]>9~6Y^!mSa_ #&5?]'Qe{Aq+~0rntZL~"~(M+ToY> i͞ u` rkƚNjφUƗZj:ήF6v![xae6FY cӛb|?;Wj ~W܉ fSi _<>~mc|@w]B)]G*\O#4.~[MV՗ Ч.[-OfH|Xkz?|?k6\Z>G,՝B(5'cC}θN~#dcߏ_Oُnx wz֦f\F0a#`eύ |eI|z_. 2Umԃ$X%Yo86km뾿U?#}~"­KOmS3,R1)Yǿ|Zi  Ͽ |'xWOy]$YE|FE]İ|6g_e";}&]Q7,u!O\_Q|(i|'@ǣG÷bl^EtYۊ'+jwE ZoU?>Ͽ )w<:of]JT0U!'ڛvG|D/NxoB<7;@_#k 1c?̶vBA1캓q,Ea&|L>>x]ûOfd\}KlV(rh y,k[eY+gwdeM fZeⵍ |74vn[ߴ__ڛ|1^6[K{Y_.|ʦX26[9ϕZӒNWv35 ~"xujxk+ZZ;f%<1Q'߃?LJ|O > X9 FcNF읹?v?` /<+/d?ѹ/AȒEw+=M#i4%3+j>Y j4 %ېp3ҴڶAS}oo]~3mCǀ|6zzѥեɶVL#]S1|^$/)P{MjoO>5HkmvJN:O|~(xCm3 &T Hu vF"<\/տe_?MG὿$gwgxVFY7mr7BRm/GJt^VV~?hOml~-WMZb x(zkֿd_Zi~>ִ]^Kɬ58,dnBKyXaq־E5\G.o\XN0ݾO>wg5_cFx >&H~#P:USr~738Z_u>Q|^=z~$9gk7=7zt^Xm6h~FTk_doڳ_#>8|`Gӯc5Tu);̄d1U'5Kr}7FVn~Z|B~Ԛ= ռ+h3k_t\ok\*I'kr/bI2ң7ݹG/e;xƒ{y$wUoݐv_7_/kkzڠ K(a l|\SHiR'? oŗ /GGꚗu%O9Ikɿfm)/ta#O?'sx:M5U',D09# IoCW7ϊj g6vObJm8n0sx~oo|it xJgo H5k:d ?9xÿ|NNSKVH;ؔ|1]yg[8J/nw>Ң+Š(((((+/ZִxOP׵JHl ion vcu5.J*qMTjQ^3#OsmZ𿊼ApfHK1 >]l~)ys¶.HȓZ\lݜJhޏC٨S#!xޣE|+}SUm?O["EybB2~ Eⴹ®{5_< <96+H_[}KErLN; W>|@_>6ڱ D6v73E⯩JvўG>O//F񵝤]̺6B;[i8?/?, ty+^/3ݳfs8E}ÒzW߆$}3þծS̷uXE+6q-noo,"<.$SЂ8 КhGE(' 7Oŏ h>&ܫ{,v*NrH#6}B0W=σ_Muw Z:-nž>LW M4jaۨYzs_T9~0fh)>W?2þ6 ́OԵ]&3z׌}1KtF3*Bsc95Qi3p~6\m ^K 2,yT`q^-E6|\f~"xrVXt i!$1n Co !NR}.Bv |}k Zԣ'/ 8P;mDIٿ<;_ xKJa;. RiP2Ēǒkzg?73þ kB&jO3*)g`I¨$4ߋ_ hڇ4IWՠW FA.K= 㧌AI??O xºߊ{;֌Ẅ~iǏ O⇆MEsݵu}XwCMS娾Wge.T225Ni'|EA47M- fv\./W|}NaJ9#?1Rv}jZ4>߄:/`WJ㰱THiFwv;_L 7ό>#x77xfluxdg Ğ%<xŶ(`A՝STd+ZWk~x{ᮇsǚ.]i]'V;k(b7' r1V?_vq]m*{[,bLŽG22m;luV> ¾׼IZhz-Fk(aE,xk?~՟_PO? o_'FoׅD:] w AB]~4 3^v47w_!' ARqrNҊp? ]į>R9cP2LIMm[L{u:OV3g~r!K6KV7;v'֋nڈ>'~Swgj<Ş7tf %7uF7߻G4{$ߎh XwhQ,zNswpR+_ ,T! < z֣X}۽մ˹&ԫ#AWCt_xJ^mh m/lYbee#\..o >7YiR5HmKb07tKPy])]]?)K *<'}\ݙev$a@zykᏅ84=ѤZ[\ 1pGo⇁>!|5ռEZ?mb&.cIsn_+Ԝ}^Q_ ʟ9nJ_+8I6Q\}Z/|Q뚶u]jeo*U<x O1/I_˨. &"FO-r<Q}W[I]OVw75ᱟY~&]~O:|S*ׂ34T@-wIzǮQ_-YhOMXh ɃO;gc? |^_|Tſa_X]o#!vqڧ8wTm략EpįL:%|=᛭k4i6o㸎68bj3oO_xw_W-|F7zrzH$0 I7?"8kNdǒOWVy+Iis C2$ pA-OǿZK^2 3Xw׫RH#z?/ EG-zucVc g$)BjZ'n|-Kë ̗?eܳK!L#}X` ^\n?3SźU|D5 ,a\Fq)<uټqih/.t$SyHpSNjOaYt=kOմ{gI N]O 5R||+3|Qwb4-F_?eε>_[vkӛ}cAbRr{TwO*1eL࿊4>KJd';i  m>cotxFt/xSMmB]=ebANa䏝v5}G~/v~(գY4.]Z%W" E E(%VoL (n.-l为mR+D$nڳj+=@|cכF{XXJlLLFI߳S_^*;ga4V$@hR3NJ{xwW<[񆓯xFHg,o[X2m<_'|Suk/Uh wQMN!r.caY#4]s/=>JSݹEÍG?R:o6֟wj^fw~Jr|nҾұ^Dg"m_;3t)xdw4ʒO*2b8e4يv|foۃE? eU+kL-"xkZkU$0s.F>L::V_meB>MkwV,fr 5*f(8O/싁v_UGik;DR.5G]AU>>|0qR$ྣae㓨(BX^`/ ܱP yc7=KGmc$ȁu=ՕƶOԄ˖kW]5ڋ3_쓩|TOOZei Mo&68s*eVhSO-S+L)xw/#yϵ}s2v&b^]jք ((((߈>xP %Z1$nWS8ʰM ^ռ-}2k[g˞6psXԌfUGOMgAo"1^?%o2w*$q.׊<.> /Mtm9ė^i٦2B]6#fԿcُVnj_|7uk'kB<,CmF'5*R+|,D޺ ze\fv,՘5i{Mog $oV%J Ha6 !̦LqciagZNWj`~r~Ο_¿GmCXגs#ZJmй!I<?K~[yj(C^|F%? О 5G,$`]KzKxo|dSQ C# -R n-_ -zk~N7h7';,x灌Xe,~~/ z54 笾^|;szB(ۮ^h& =OKj~k~_z/V*_:ְabZh&8 _߲W?_J|ZM3~c~v't[.̰ 1Տ{Q~5~ះ Rm.&dKP̅2?߲_ s\]Ožҵ3u(KPYǓۤs'F=MM%*jދ_Vi^*ЋVux%׵jGIm7g->m~cs I3<-qmZmr]y.Q|#,Ns~C vA b8c@?*_f|Q &\xD҆ݾHԄrO$9jR[5k^hZ4?_&~7B?`e?{$WJār^qӚŰ;z-2xVYF| F_$X_*Ygtn_im6ryf<`WՁ#utoڏ~]bIs1'jWڦ0vkmo窱bn~DoAN7&/5?-ova8fh-ߏ%`L݅'J30@=~xU~!|K>2GsĒ2yz0x9OPIq+طӎ&6y!Wo `tݝ]!̷i5? uϊWovwW =ƺwON-q.1i/LwV)mSgou(pwH0}ćE~C:|n~K_m^@@-!={WI7?#vmlh9q!8m=j+^V_;\> ?&~0xvkxU}VN*o K!uFwmV, 1w\1&Y.Qobl6 8`W?g߂>gᾏ~$EQbHpp19fٟFxw i _*ç\wo,Al>cPvck>I56Ui{-z[cao֭]K7 OW+ی"T8Kÿ k:VP[hwj 2Ʊp{p_g_txNiOj7sHӡן|Qhs#~&""h:j =Sy!۰\&ջu#5iBi>՟\ e]/Gvvs g<_k|~)}(|e?mW^WMC)y Q_kMIc?eȳ3^’ 1ޫn]وTo^^gޏ{}aBjon\(ls!bS9M5u-Ue{o|?o>iƕug+ZM sڋewarB:s_g x5(]kFUWז?2~ wO%mԲ.w6%!Fei׿ce:Kx25~(GP"6C$hq Q1~.\i>W9ʆ<7:k~/⇊ m8;ؙ'spq߭sjN %nӪ>#V\?KnX,N|cz/SW}_ <"%>DIa1n>c_ǿu/ xB'o脑J=b;^c٧?/ xOᆋxv[I-6;ݖ%xR[zTӤ%鿖y1Go?>>!|93}kJht"+I|GԚh |An$%ŸFTiѓ#)&zᯁ#77j?Nt-59uیWZM[ Ѽxq4 _ %ԮZ0rcG/*꤮1R%%{'tJE+z_|/~(:>m]*r~7ٌ1"* VʓͿu*kx_wi^O# ;U¶28 >Rͬ,,Zbl6ь;z4>_xAݶoH$Le(ڥHqkogV#?dό;m&k[vW'b-++|;9K>⤾:glZgqo+'W'53T&v??˜? H-7W)`؈ P@ U,\?r#t0vE}%o~q|wo_a;We-Fd@88)1SK 9N]Aaָ'?'+GYdO5ƃw_]ci0 C6:sOz2@*ߢ,| +hzNj;_ Z~w0>xHI.MYuIdV?_t_~<7Eh:MŅ"b]r9s\k)giLzW91\glҏ-{\5/NZDډƓyQm ^g^-ƻg~^x^37!MR+_m| - ¾6dY>8{Zf.e6ne#+h |>(fƞ!8U 0- cDu2> nW_jYK4a1'g(II?$㉆uOJO(Ybs,06Xa$V>ß %oHݝ J41C Ks/ ~f1e߇ڧ ¶sxmjXe{mdE(qҝ1wUaQmc_|_:Džlb1ɸ!:B9TVvm$Z39b#&I6ݻ;/|wc[ׇdVcŚeg<5Z&GSknYde+Ǻ;1\xZjw_-1m;$&\>˿1/¾"o]r0p;U=sHIRok|5xks=YJvHIIe;\'5שCt[i~2o-&iXRm{/aZl$xKoP~Z|V]1B^(/|i&-5o[{.H1og?:%s\;Ӯ~e vr]꽜y_GL9Ut7V?.UxmL]zoHBBu&wԟvn"kwqbn~ߙ~__xw>F{]'E8,ec`Izo|uM?ǚ׈5GT+n ~dL n\z+J`|ݻyٵs8nOx$V vK/zFe0dt2p8ggg\j6F-o7A)bXcQn  мg~+6q&bW|9a^g[ ,n>m. km1'REoUY[vm|Q>߇muM1f4Ǘe caj"<<~mŬ:YmZP$Gע?S^?Uq+ /UG4'0j(gI _Njz^x~G,-M&XVJt6ޟrNTֺ+>> S~uڴ^{1Iuq67ȧ-®8%M|$ܞ*gۼh Z]<^h;I /˜gBwdqkz>wiIYU`pB=꿃doٷm' Kxdk B bI\FpHwTەV_u{x(7w='?g?iAX> Ѿ GjYjS5 0bsk灬~ݟN?iшtH0Nyk|D|/>$]jKs%ɏe7ep0 y~<#/jW7MPIb$)!FrJBN*%Z*ZuO{ Ͽo+&Z"\>~⏈Z/x"]oUz#T>N>P00wG9+Ey~gV\.$ǟ۳ϋ4)g|g.iANq/4Q]@ʎndS:)/.#XYj*|*l.1!gR'm`e dh#ChEcI,vݥ11 $$oTRͺ|MS6:MAL3!`%[h1ځs0T NE-]OKvI.~Ѿ/;X"=]#ee 7e*|̋&i$%ߊ_yCOP+=_þ'Xy>{%p#Es26m ~|N{X|]WWZ粽M8ߩGPޅy&|`+ٿVo|in\%̗"A4 G*)-ӗ#Nm;O֩KtӻE/ī_f߉/>)xo\7Kq[B($h$1ZdWVFܟKo὿ :燼wA-vQe"[;Y)SgiG^is-ŕKylup#G-#+/ rw+q.ߊ|Q}yl/o}5S< a f«!KAwk]LNYs-➶Տb{,Q"Xw~ɷst1퓩)n5GM[VoKÛ6m1"ʱbyNH# q|}h xXjWSjʥWhtTb? f_eK|25:Xqu6dG#\XQQUk(ҝe4=oRNߒ]oׅfOV7[_3Q<.ri.z|F o&uL| )Qد%G쳥Y'5M6;O pVVh#.Bl6P–"QFU P8J馚mnVNLEXIEA+E>gߴ Y'ھ.8F_2HVXWb߳ϊ?e!xOZMgxViw5duMJ{8DH$Ez:O~nCYϩʏs"H22")oڻCB($(((((QEX(QE(QE((dERQE(,ES)QEQEQEQE6(QN(ER)QE(`QEM(v@QE+QEX,(QE*((QE@QEQEM(,EQ` (((QTEPEPEPEPEP^OkW~ g BNu{2* $ǁ^_SXf߂H83 G6I=aVn yRn/rWߊ C+R ؈qN%c_c:u״xG&#ͥjvqI$eC)*yP_#G *骙o~ 8|c-~'~F Kg<2[5\sIM]l_4h).m~Q_??g|\Gj^&{9 THĔv)4> OŗZ>wia9$w߳3ܻ c{K۵mA"yh~Q_?8އ|^[K|p#HAKf} )qhVGP)ޱ/joO3y:-ƫ+z1 6r&!f)FOO$}/祯TWڣ◅>Ԛįkko|9ekx>PɌ\pk ~>2xF-]wTy7+nG+;B&ଠU_7Зkwd+j~M#Eg4Lȅkհ:s^ <|`WƯ>-xMgy׹#Q~ȸ^ J|TWƞ?SkKψ/$3L>q*cQ6ߙ_W\njc?oMxt>*LjuӮt>I m sh'l'|;4ү"3mE*LdQ[ݧWykc]?LړvWxoMڴꗰ[ +8V37QWBk߱?T_/<)w64lQTpN2 hmoF/%5gEgrr~מh|7_o u Eɖ[sECn-eC^GړI{?ih÷C5D eN ,=>}_Mo#/|6SOvZc#ZkK'0Aψzů5Mc}%u)m-[,ѣ2B nizŸc At]Y *L@Tbf8Sk3?~1/wǯ^~ N6ZfUv*|Q9d["5exVUVp:~~5|8i__'>"ĚUvZ[I35bL;2țP>&k9J_ٗ~ < kڏ'6ڍ*p>ga w|Ή,l6J5f/Tw.,&sf vS=m"E4r|710QhxƟ 64_]&R+.`ye[u#}Z9U]>_Z?Pq,G}ᦛ^@Ӆ,-FVS Gvv}ZJ[|Uýc^ [kïyD6c'^v>??}?h|P%>&4yD;kn1mPx䜚< ^:M_z,t=P,133*qJQ]Kw^+Ak=zTWl~ 5&']K_-K&]-?-S9RKgp'q=gϊEuMObmOΌ 0$k/ٷG:~_>2x+TZFs[I AGEdSMzzeǟS~0kp5+% ZiZ;[eAbd2u/)ycMIz}YV7ATcns*U[՞sz2|!WtW^oj2En57]AlEHne38+g5'g@[v;HMkH2FO .0|+cD|^qZx?iO7WϡX隬i2ȱK91mUaF 2xGSFߕTos_P\=yoHtd ZE'ʻ@* -̠?JqO^ \:W|QF,uQ(zyEw2'!zg M 1-ř*Dɸ8P3$[;~}[m◍*?uOk~ 鯨 '{ K9$ו^־(|~j_>.k| k6Ȳ"ث$y vcI[{&koW |\}UZ$zށ-jC51Cp#sl8 ~5i^ a5v>LvAGPŊ@&u-N2Z`T$87$ϸ<_ ޥkVޞu!(,{r~5V:LJum./4kiUr'gio|L<5 :IJESjsi vᐘ$ YπJ?T_,57ZnVvLx1\$M,qǝy5^ѭm.OSn _/>"$xUCۣ:! ٗ⿊4_ |7_x>}R>0JQ$H>QcviTWv\>%_E~^O[I~~Ӟ4.tkEtC}+6wmTrȪc>!~|5+UW',5o$ڹ ɓ  ]OU{z=-s+ú㏁6z'3ū] $jd9}0cw⏍_ſ u&$wlm&yAH<g ׅ[ƙm|G~[(y~TV+Mymϊ :o,oGl|@|Gtu'YOyfͿ.*Vo[ڦ[V~W?u(_ 4mI]Z^Hݝ4QjKF@E`~py5p_>8Bkoo6(d(`4n{Co׿ ֶOg5+kڃO5/c:-i-4-;IhF6VmB@w\T.#]W߱k6ֵ 4KZY!Vv$zOV&*Rtҳ_5W_LxoO?ڃ⦵_߶K⻘ ì*f,}6滏č~% %O6i% ծuYjzlڍ򅸸He*OW I$rI|R?$'_3?j߅.]L,Cyj.@;z>V!J쓳~wyC&_oCx7g=3mC<'_x]a5 ~v&E+QaG'\_(^!l'ۼ!€a{y}Y3#o|W S~&IQZ{ _F<׿W_(Em|#R+xwF& .WM.Đ#Coq|\G6ƾ ~0x⇈M]gU׵io$Yʗ" i~DT;n^w#7QZ+2Fe)rHQW⯌;;'ŏXS~5xu˯oMO-ʰSDkڸ#'}H|Ju[~()>勵GX%O423.{rhuT]拏)a]n~G9|y៎ A_(kγoo_xJsI kZ5;\6*c(*~ůڿ qş~3cq{q0;Ձq״J+W3cbWmO? tυ|;ĸmOŶ8<,`2`n?l+ KUؗᾳ;Y#е|RkCh{to-n|F|@.>0d׼I|l''#4\]FَuFA$* Ԫ]ur4Jhw?r(|i|G~ėhkFT'1L;p-3_?>#|.\񶻭xL!w]D xܲ,R<@ .U9eFמ9??e(Ý?w5>>x;Z֓YuH;+HČ n&쇍ZIPwY37Bv$'9ݑ9KE tڼGg/xO'޷ۮi-4.&Ȼ`瑊/-okaR|Li&k)u e Wt[㐇lTpy߃\B=kuE>6஥X\-Rk |Ax5.+#ǹGAWcD|zx○▯i.1*۴'LGZy)?+~;on?|E/_r&tFZ>`^Isxs㯊?g_kk^$4|cyuN[QmH͵VI#TG_??V}o?X+:|f~izֺb*)]쫀X8~Xxboo--wK^_?5o!YM׼3{)M/&mn>Dڮ\瓟ي脹zWjQEQQEQEQE7O>71iwR$:Ťr= A^Eg(kSHNPqvh͇  ??jOXkcŸ`YYb?(s!m YX|o:Pjz$+Bcx2W9Z^d)I?OT+%՛G5&fe#? |.ω:|b["IJNrw@Q=89y]ӾYnYQ&0ɯ(6[ZO?)5/&ny_R_oRx\Wy x,$ipnGCv?li|":^I-u$~GDmzʅ--xv#.0/-~zj{[x|u'hhְh{k6qȌ `tz:3??}AƗ@0PW޻_+j+ND;ufocg Mf" hٜGGxOFuxu񗋮|]뺼ڗ49ZE6L9$+E}EJKGmW~߂?8? Jx|%wރKlaIc DfM!U@ڤ3z]7 a~I3A^ 9鍾__F vku6Q8:($ V'oO_'?g?JKx]j tlCB[0`+&ŸHПV{ em+cb`QP[Dc2w0>F 3O^n]ϙ>͟i?&Zٿ|&9Sgv|??"K~Ϳ$/|afL;}**MOwc?~^s.9"7lH{>:^߉< kvu>K+ѶS؎"(\Փ'̥}V j?,| /kľ"ރ Ez:I Ć0ѫEMBt~5~|F~-j+i::i2kfq^ڮp@ҧ78!Zg~7sOU˾ʿc?.,(-|F9<~0o ktr}& yq5N _6Z{Z׷s柈@Lmq$~pà\yj8s#Γ3EFj;xot7cQȌon']wh#ۿkTJ;?'Gk|1|?]B%0 c;>)~3 x??+XR6vGXºr s[F1!SVL*&( ~z Ě/eEqn.\Jn;T*9ݥT%0UR} $ֺ'I m~'N _h?kBi|g}ӼIOğL? xMo$7oHo4*L{etVVd2=iNk k%gkjVW5M hvĐ2ʼn7>}#ÿߴdkQP]:XG]|vorA_\QGIj_'U[-iϊ>OgCUx׾-|7,!񅦗1<TƸ݇r**\ ~?o5ϷY?%g[̫+dFvuq1:Ws>&~__?-۝gL+Q$xm2gQTkg ܗ[outzϋYTKnЬ/8NV8 Z=@WXo\h<2Ϧ}2 Kܥ,1GҔPEG۠FG>??b 5Oj.eGeHfBώJ 7|N׆NpR 2-|%͓vݬۋdl)G4s"K 2:jQvvƑ4Ӗw?* c⯈oKY\?o_~;x~Hth6vuiA# Ά HX;y҆mxcX@?M&[h#Vm̱POzj [+ѷs㟈|W5|/?|Q7tFoYndU<9fPɒO pu><-k?ifԮtt: -4+(yO6Lbˁc(Jʣ}+%ώf9/$h~YD g~ҸXjO|7SQ3ᝂY3!0=pv3$H?uQCaFH߹/ݾӞ*ycV_ gk݈7Wl^Y6m*@P rkƃcf\$Pc?Lzgp_+~7*~ ~"2|%?h|J74z8٢2PϔsL!`6W|9_՟Lf:oOݿ?u1k(-\%Zt|_x; yu/Jn:_8?w=>¿o>SkMټyQ<ͳ87z裕+Kc79[{o+h_<aj ~zCस{4q4yh^]o؏[7O/h/%e6~54NǘiWbLpKX{_D|1mὯ7_Y iv00fQ\cqhm`RZpms߆Οkߊ"76^P^ʤFm DJK,$ޱIt#vzZKJβF v2)$20+_xT-[|5k㷊>'jwv|P<66ef^Vpr:g*ggqs4G1$a=+'M6k TM~g|'Ѿ54{g)|owU53f\JH3"( I<? &6⫏ CN5/4a5ƧLBKcdhe Wq ]cEXckɠ7!6|ycYכ+ea|eBM޹5pN3aV<(g9~Qo}>ޭhֵ?*ŸGQk)e}ۯ pp9$i y9 v_(ƞ!a|b+Z zAdQR)iw6۾;a?rf_&j+nldUָf2p%_-ۏ=8^'?'~{⟉>M9'Ե1$|n 1S`%Win?Jnb#Yd  㸖"]15??7Gi}iٟ3k柋_6S 'ߏx8tѪi ]"> o4f*v ?XuOw&{_#lVl<hۿx'h|>4}B[_?f/Bg*y"ԩ)|:ho<@d< /!PjD+5|s;Pz( _XQi*H,&aZZ}Ԗ=}Z0Y~tiw*y?K//s_>ЭA{[ xKF5 5͓j^Q 6V8VcQEW,nwri򨷶fh%kh|.ԒTi^pe?֯,q־+'SrIvV^EUQEQEQEQEQEp$xG/]s5!oJͺ!v98UU1 9$#I] I5I4,$U (1H 0aǑ/<f6ZԬ/mu)8̒A U@>moį%w 3CNju=wPm ԑ/ /-6]دp E~i妧J=}k]lUٶeAr졇<sτg5ī ]]rlZBHaYGE|B^ l׭~ /cXOr5YpD Пr\^>խY[q*倣,rJ arnJ}{8/-{o'>#jn%σ!wkp4$z'ko4o׃uqivKBfGğ+R>b+e|I٫q~'Ԭ.4_Z~k i=l+*h9 {c׆3x>>}{[ C )%KnژL@NMJ}mkxzJKţ~n| _ f{>!]>X$rn9 {eGޙI|Z^ K|+|l2CeTqھz*i~&O:cZQmY $LqךxOk+;u"W͢/+g15܀&c>]ʂ*.Z-{^f}/d}>q~/jVMiXf6F(Xvo;\us8u|34:ŮŠc)wcpTgb1y1h&EOp쐡~.^ET]8yzNFIB~BQa8zU(W2q+ϋߵV_ċ5/D7ڠM UTS,`峗MSswO461tyo0@;߃/ҌNBW֚OlK6׌)r[;}\)Z۴}ُO AMCE#O,R(eoS>~^+i:t[  6($!05쟲ڴNo)":J2Վ ~AkYd͗ - 4-NaqiX>B+"ݍʬHhȩͩm eF&_qu? {j =XO6GtPX<q^ǃ6|#xkjQ1We`A= ?MC7㟈~Q4?tI^0%IFf `;wLhnz]ss5;+" !Gh7;ߠф)G{Əei Otվ% :)]35~?''O+ym;¿ .U}c#J ǐFH1_ɼ3òhX{a)hNSqI cok/ٗ+:j _ϖ f'u,v1rS{?;*BO+'Ԟ )W_ xV?gk+೰&b4Ĭ>A*g]Wg/ ~h) V8>_ێr uٯP߈^6?e::{GU&0c`wQNt'#ĝ>O]h3_=m6f @Br+NyVH];5ekO W5_x¶_&͒%Ҫ#ȡQC#8?qFwݎ6?;Gz!ui > r>+?T_ Ekxv2|TC.|gqn`9^8⾸4tymm|En pN=KZh\Bc>Cඟd -?Iӿ"]Dcʹ^Wv7vлo~؟'>Ϳx52# "-ǀ:L s'c@9,~؟>Q|M6KE,V;wbWWv@]-Z|LKfR?GV^YI_4+)UH-{qߍ$e5Hx$%bm'r8`EK&Wfmz5iRk xe5_ 1$5qy#$_o?*]xd>=feLVVMJ<_~6X3;YpV#8_CEV1 /B!XJUW8*\՟T╊Qt㥚_zMOڣៃ~ $>"[xT\WKfNRRN*0'<< q|1?$|'/X`o LvF] 23 5o?OVxR͇z## J},Xitܼ8IUUnO/+QIiMݙVZ|/ѿ:o%4:ׂomትIb P`c7`^5wԾ ƙ%֑ &/𯴐sFGS_?MK7[| *ŭ3ӕ[xى'~:WuhvJtӷs7NEo7~.|/-kO]:?.uLx7_fQKµWʜN Ǐ> oE<5-|_iyZ_+/ BDwrk??Q6;Q|%e7PE α͆Ed(vq7o l3xoEHu W^ g_.umjH5\];-MM7ůGxozׄWZׄ<FOг4kaG¿ŏ>.7r?t~?0XtSxAA>&^}?{fKh0Ie?*`םxW ?n^f=N^ ү- ڪ#:F@Ș/ 8,pjӣ~= /MVi۫fIc|M{t5HOz іG*aσg/ [=ZZ0q$k;Wƭ+ /%<CŗZCgI }Xs,J>A¹# q߶Ǐjß^ vVZnja$k4K,6)n q)mѭ t&['u}z?i5 _>!MΛ-ZŻJqGKk׀~%|HnVo4:όna=E $QKnfA@Y\xo/fj5{ Xb2DmU4#a}CKI.,|Ag?\ %l$RI!n8.~Fr %D?J$O o~cǧ$h{'.<9-/R|;ciwIy^@OedF {Ѿ I]<:|0|4"V G+220<ٗZxN]";GKYmirryCW >muI>i{Yu亟ZxŚ>k2F_tk/5K1s?n_ `=/^={K5a׬&ky#܌AîW/+>&?=׈q%̗^L3Bu.ܜWOŏ' |IgL~+E7HdbG7)OV:0iM]㏁麾OXsw& Io %e,ɯ8?m+|@mķw/.^E3 ѡe[iCG|3<fn//=s=jaf2[fvCN+g2\xSaKmaZM*%k+[%}g>DJĚmHX/26H~_~#|gdύ<'K/uh"O֘JR 0@8$[|4G>wK}Zi:u:F2\EGx$I/i?# c⇎AY^[X.Ӵty`$yn \EʶI K\JkoUx7~~ڷ_=𿇴۸n裸6a,T;2_3׼)|33qZ)m$X+f`L1rr+忍_Q f//WĞӴ}cJ,!4. sgoʮ q^@XGg3r^wՌXc"1C*[.eZ^YaKc5b?g4_K=[:q۫wʒ`3?mυ<[3>0cs>D2j(8$'pq|E|@_ eړ|e'IISb5ًL3ɩ~!i߶W[}' s \Oz'NZ~Owlkr f9u;hUr#3߃ qZ ~𮟪 #SnalW;W,H UG5_լj #c-vRhڵ)C5-%](+G'=q_;Z]kIyw=[SONाխ}™?຿WşӶۆwOoLG> ~+?dž5 gO48$ي{#| p~Q\ċ{̰[{v?SWz2 7X{#mLgj2'X\7oFu8Ri_[o+߶˾ j*`4N7)]4 븀r@>'K糃 O=J]?]ډ{,s^Dd* demfACfx3i~6cKۍ~sut{=T)0W#>.?j-7Zo|DV!4SmkqVU]ӰbۗqI]TiRM.wxucGr^:KCki%>g0ͩ*qvGx3oO uxƢy4m+1yK& $o^ z kxoֶ3`ФZK,F&";]hO>5gOi0ϛ18QZs?;XNKmuo=,RnS|uxŭc7&xf8ac2 2|tnH澢e~7i-3BRo&{UC!Vb0cs uc sI|vi.ߍn5/ ʺkB$2pv;GPkSqԟŚ k[/e*FZY4Ql`ɌS 5]z:T'2P[X'K جHJ7y%H矏 |R@ [+ /=- PDŽ?-x>ִ xLR4ih˼`MO3O^vإJ*ko^;:Sui*ּ+=;Ñ]a X1tZVb)i6<7-c/Г _^~֞.A3xGn|i:`d\ HVpkM^>hı'X1xOyk[o''(=Wf=띱Cm~\vЩf6M)o?ඞ o>,e4p]B?r:כ9ֵ =j<#Iu|>˻e٤DGGy-zY?5e*0n=ϴ4(kϋ<_@׼/=RUТʲA2oml1z׌jo U4ciD}*e?N3y/ ix;]BEp㸜~_>׏o_Ek͹VG(y^gʳQ4{JQmhi}M^6%*@Fpqt5=xCտ࠾&m?PZ(m Hpw^++4kgyr;=B($(((((kQEs (+#ޓmcTկ,/pꥂr@fڊINOW.o|=W+ˉúMnȌDꡆTpxfbOQE^?aExgW?? MS:u F}`(b#1"58.8=k߻{TֆN!4QEUo0QE%^AEPWQEV{<7'>x°Z 5VMkS"ys^1- 3ß|D?#i4ۡp2BcHً1sBdS:^G>h?kotXj 8e|wsƦQEc{EV ?Q@{EUjfW<d|'/׏#}>[7 }+>(xO[<&gqiҥ.-JeHԳ*n dp*y[r͵uwc > ?gFln47:dW֗eL+m$gpq]Oᔰ6r=p3C3fMExO/:(>#&Qd/$60c<ڽڦߎ';Yosx?/M],ۍ&23+ڸ>&*)j(/ (ŽkG|xz&l7rRexg|sGwHqBq}8>fQF^7|εf˽[\4V4-:aӼ-kw)b~1(Gإ)p?__P7-A`@Vh6 xV( aTjQKQ (ntWr| |EC^5/GX 4dnym~|5|Mmo%aPˍ+crsF$?ŭjP~c.}qk$VO!vR:ׁ˟yټL{n}վAy*wQ^;X/W^)S.5ZFD .%w|y|M>WR/~o~ ogqÖbu$1X|u2PG$UO-m+ CTjoJ?SԼ +X}!;+K3|QA7vQUbx(|;b[9|'>5|R׼d47YnL2[F[ʷVw˝_RQE77[[)9(߁ o>׼_]InMOPd$@Zű@Xrry'*({QfۖQUqVKֹil֡ec-Ž?~ ,kכ|=[+gY;9Y4qT0ʎ z+KJ(HQE@QESԯ]mn'~73?o T4-%k=ƹc;[Ci42վ]X⽻>'~͟M;?^/oln1km*9s>[3W~-x|࿊x|wi\Ӧ,Li4D~qUeI {}վ"|??kρ:|D|;j!i w'-wwn@5߳7S7& ?&4Ơf28cGtڧ(Y44Hˍ9&J }je{ʫq^V f >*|vbѯu-CQ>o;;s4US=v:ik>ú/t @N0qۅ^~6S_|?u=7K5uxtu, d<5i?~?>`[ gۏx㶻_jYTZEF,ĕVR+<7Nm/|x¿?>|#|linX<Z?>_g~#jM"WOjƞkm&@ǀxV|U+OO|Q;AA$Zu;, C|> %̮W:j-&ݞk:{/sjXTdmHm5M۫l.vH'3|[qoZ㏌:G Cួkv>|;M>O w+0o+Zo״?_þ$Kf Q>30x wcj1Z`g 3Q}GY9H*v3g7?R=Q׎>%~Wm>Ovfx1FCc U7>< B MPd^ؑJY#qnzR>.%i_^/*0 gJp$=o^ŭ|Eiþ&ԚPIXey m?ڥyto*& .m*!@R6\/`ɡ`ZOnށhմ{ 9M5W_3U-tW?Qs_Gß 9|Jmh1]Kd2{`ߵ<:o=DQn&u*}wt?VpX ſ>9xG'jdMҖV ’%wck{'Sx_u|_/xsQh:`WY%3((Hr98wk˥U))Feo_?Vxj>7{S]fTDre#$8'+ٟmZJCxV߁ㅅa*9  K6I?٫{_ƹĔquji5ݣ[ك(lq2}~ζ~4? &$ 8U@O+~@] 櫒JK$fr}Z~b|Fj/>Jg nZ۶[wdž*rrߌ$ ƞ2wE=|I!aU~@ d3!O[/%_|5Sikmcp6 !E|/]~S}coǺ›G/)tgo1.rfDR-+TJS}nGwG0O??5 ݛK۹Z3Ea-x)x\4KTծ %F䴪(Ɵ߇>~2|?/~4Ҽ3o]*eՌxbqpnS࿅>)sq_ǚW=&n_ė yfFfU qNRW1u[[>kտSx@ѓCGMS0E@ٸF6WT;:k橤7MH|W`w+ ?iO[9|Dj<#8mD#_I~П;~Z';}I c]\hwvb켅uꅗ;䚋V^V'RrK}o;PÿO}ž׵_ťM$b+x\gnO\>,|\[t}SG4|Z ׋\Wn#  _ě$UPd@<>'=W/]oշҒI5Efp.1z׽|dkCRDž𶻣#="FO^˕K&WίWd|+8 xW~/W_Sm\@dR5ЫsH7OdO;$4ӴJ?* &|B&c7_u$hҬLC11uArQ+wV|sx7a֛j&](inm~FHPp x h*{Ő;ZDxzL.@WiNܪ*Dg~K/=nkVq_/O=h/^⏇yh^%K4ny7 3uÏּؗUoχ|%[HW^M{ ? #񎝧īgG$ʦ!ȨY|T%2}{h+Anqىlr6fT5k/EfҔm_k'S&;R634É& 18#wh7߈m0eci1{{Im)NI76ExG+xG%z$+5`8P,I$c'=\ot&?g RҵαAYgQO c I9c,ioWu:t6Vٟ.|q!|u3ux͝b۴m Cr+*K67W$3|j/x'ZV^"+B^{goTTh7ADRO/q |%|3*>+xw}fm46$:jm\y!VnݴM+}qqJ]ߧOÿkMk Bohntz̊qn+5o 9x<_-P|5Ÿ7K[KXKM1m =dZ3KѬѴDy*B \?cԞUNj'&6Zr3A"x0]6ڧSZ+;&W̮瑩n?6~_< MxXlE໛JIf-a6cX,xvzׅv@(^5bK+@$es߰w+|xOJ.|7a>OGӖHK{WV6m 9Nf߃Ac go =$I#zA ˕>&Uh7mc_x›xSмKz%1ݸp޽W<+/O xTtK_ln``c xʜ^'7k"/|hnMb؎-φ$ۺB~t6w^(?QV"MlBAuҵqn ._9W.}n$?ı"鲰ul2,t?1#P:1y-X¸@0gA<̆007c"ܜΕH)5_ڟ<F |H'^!5 zѥD?8g_Jg5>?dڧVѣ( ®;wX~=?c/~ ~ў!%k]_V՟KH[v` A0<+K_+-RTO+Ǘh9}މjg`;WkX7kSmHlkZEW,y\m |~}j$I~ŗZ{jڦxaUc3@I'p&WTW~YK(St*I?3?_|3k4VW4krDaP9Y8A֧DeFr^j ?&C>DuG~X:0]j qfX!Æ&O>k_|b~3c"% j-eok91)I`@_ɯZE?+|FWyd7&b@N2{Yx~.^KAx߇_y%爼9k<ҟޘϘӖRԂvzt>,xu< KDs9$0f9:qM>ڷiJ%bG//oyvݿl'6yB.R{^ǟ+ 7K:j^y:α(*# )8xA4?ό^k:9h2y2ybc0+M<+*he@NvI*I`:!ğd? +k?> xլIOmqlT18sgw}CF˶V٭G|\[ğ?hOڇdYu ^ twkU(Ul0>R?j*='?m7_:'|!m"oE(Ңr9rk _[e,\si3%eCl,H_݌ j_&|+V\Oå-a,$n#廂xU9_-k%i9{do{YmCM> .~ZRO54O'}ۓd/޻m+y' +ޭSpjuŀv2%eo䟠i_goxşS|Pn6B0/"2De; Hu =2+s?~>3x4 ޭ &JpNRodSIWuG*7Kƞ0'PE-i{F51 8?/gUlYXԥ=A|N'U`%$95ku|;kG~>a4KDu #raRG߅4g|B7He mhl>VY49q&%tst+Jg_"Po,wy훾_3fݷHEc|\}7O~V{J8]d uc,RѺ\a~ 7i[>3xw+ X3u ى,pw2-ԗf MӅ$w\ g_%Rj: uuBi;2_ޣÿ?:m~2|杢iZ[G&;w+!>pln|+cSCO}{Rg⋋닿V-fp8\_d 8ɤj^ix}?m4b9sD :9&U9%՛ZM~7]z_xSu{S?LHlgkoa#L21T|GxD|D>nz$JI'iՄhXm*s?]=*Ok=;jþ,֬:#x㗌Yi>Sv'srZXi&:kJoW'Ysxi4=Lⱉfo0jg_nj;g|L Eָd-ͻNy@mvG^ǟ $^ c.TƩYä*i7gb*[~{E+xCҾ1k_Ooj߄o<.|gjOp#UV/o Dy;X~ԓ-/Ğ9ׯ|]cz.k|;&~渏!֥Xڨv0#>xF{S^xUi@`0#ܻи;0x9͹QڻN>O>%=-xM>$bj)s&kH$K$M3wW!5ǿ7!} Ǟ6O7[ks^j0+H׍XDž 2#d^K|^oz7~)=ה,BX]y>~0>E/GѭiЬLuU tsCSs}Ky-{ݮ~N>)^|~xcT%DEU6g1|K -o'Ljɴ N#pk#.H>c{ s];Oᑷ<1>Prp2@듒~?g?V~l_\}}2I{A'H=6CsœJ# ]u۶SI;dzmolB|}~mXe-\3\_%M7WƾԵnPx^K+Y,0.2I4Gh]<|P",[OP4ݱoW^k`~ čcO< ɫsI-;A `a=yj!Vmo;~8੺|T<,??^0%BɈʖddÿc;*l׾5x○e5)|\5֯CCݐuը)Ta#RV_MГwv?L(Լ1l?ŏRxw-^4&Ե)H!_ mK׼iV9_?ɭ xD>[GZ rK2 Z<־_?W;~6>֢1c_3?,xxmuOz[&b\9c9*Z V-]UԁN~%~؟~c3Rռ {Ol! ai!#jۈ|!>!ִ?x$V6ju\Kk \nWUs6I# $E4(I5 ՝XEwn:O;>3,z/|/q*^Vᓕ*HO|ޕ3|!ooo$}qk [8 z᧕ ۅ8Iy5v'k~'/{xO? ]iRѼa1F=9W_o~"|q+=oWԛOos/]*M?3#ꦧE==[6>䢿+Ay]wIp98 SO/y_]GoZ7ȑ*g'(&\yIY~[PFkχ?w~%_|35gjk}1iZ)Kg.I@< 'sxP׾T">' Q!QlwaU&8YwY|=D:~Mv曪^ڵeeV*?yy1$-ƩllFʱcٚILP6s*bU{-n}E|/^.Z~xð KAuK}w(g8 q3Rpo|quR Y(9FAxFeO/#_tkTږ6h."iei.rEX-`|5/W˦kO]VB"CF?vg# dTw[Q$Z62^+v )9?~*_~+~ mqi+%[{ۃI*626~mofEhPpf2} 3u9[z:Pٿ~Q_7=|+Jyh:4.luUx#vHCO5溗Et4-wMoHi[le+[nGGoj|>6Դ{~8[?ŚmY4dӖkBFHg ZI#N)sArJ*jvShE_|=Ÿ\X7OGI эm=qqzM4-SXnu4ٟLjf$,y #O>tG39SJp5-|ڛ?k5(oo5O1kT$bX0A۴/|GBiw$ҢU@M)%+>H5+9efٻ ?GQG4r^T%?jx#/u/=on!Z͗m,}3\7?9C-Ŵf/Jl|a #23x;|ƩTiYn}E|;o;OuS <7-+K27HPrzgOx$t}\<>5 xjk'dXs8*LNq3ZIP7 |4bo*7HkYA7ў> j8u vڋXzQ$e/^8͸`sT>TUj]txN-ӫ{۪_7}}MfUFf!Tu'|;#Z'|K|EgH.&AEHZ8+:T >h+~'?=bͬx{vBPX2C#pFA#f}nWZiYYYh|%$U%?l-F1 ߥx0KaR<@=!]/HIі)%]Z,ݜ3imw%Q& o(>"^EeȬm ӮK& 88 $}Gៅ>K}[-[ MHdOr_%{n|.'qkx_U[4th,VS&̨FctA x~kj&վ($ `1H)g3/ioѥ~Ʈosj+w߲otMy4]]5pV6as^w Qk ݤt}-.WeG*#>R1 nOh?OHO?gƬrͫxyt9-緼I7,n*}obx/E ¾)-|mi>Nݑwo'TXX᪤( ~؞^ }:74Mn ,_11מqדRO6:W~x~ծlCohpLPHyCq9 ar@K^\aV[cOjTn-|~ן t| kxEŦhwV gWe*2v_<7c;ɣGמ\ME|,*J'v.=꽢Iۻ_4|k=fk+/<0J#t}ժe/OcƞNqۿ[E* G[_ o><o'6/4_iÖbwA @8$ iui?;zQEQEQEQEQEQEQEQE|tYIv6]KF#˻xP2k_c_g;x;ֺo8jz=Ւ4L=Wu:|d+io3_?xöW+__Zy:ƛI}9y`V#kH )̺Kg)x6սJ{VqI$-<@iEk}jj_Ws?a់ߵۮx_|Wj>tt$r4Č #_~9/"_鶚m<-JK`ϟNFs_TW륒~im[??oo `/~"n5vwfk?:W}'⾜ƃsu"GM%/ hʘVcp}S.ͿZ#?9'ߍڅi7hdqlʷ-Il8ÜqMx-2|>ϱ6sC_^'Yt绔3C'`+6ߘfs(/vݝʆ'n,~&q74Qg[rW渹uC,rKrU6qY]} _?MgQ7|-8ZhN UFO?QVJM~༟,]\YJJzIw c3#q_MOxo7"=2KK|E 9$`dWؔU{;G_~{kOύ~ֿWٯ_Vȗ_k%? g_i߷O_~,~߼6Ot6lF]fc$08>O\o|J#Qޥal&S 8*AWuⒾm / C?ƞ |E|k,~=/VG&KРu A>-Ib0Əz.l$$f?d\\GZkV5<;K~ږʬpgNVF|?G/dwdg .|fwIh [osg?jO(w ~0X{c$+*F-a]cB~'jt}j.u?Kc)eX?88;nWmES՞IٙiuGny,'SGϥmGfѯvcݭ?|Tּ[J 񍯌mʱŽ1_<3.T(9g9` mΓ܋v1F 0žz_UB+Wefs+¿Q'wV?xׄ9dy0 `q\jO"/w}%?dk'/n:\|4ekz]k/|*x&VmJC},0<]|Bg|e׵wi|Gb,y`,F1~v9BN88vV6hvg~ ~>/[7gRY RFc,cv#} G gjZL<rKjUdF0G#?/d'NJ> bϲ Xwn͓p]dd}9N4"[4ZZJuo?`ֿIm=M$n?5Bc$`GW~ n>,~_$մ7Tvc{idogY(ṚT0ܧk2%+\[]_c~&e|qY4|/ۛ=;ˇXdo&x|gcKrM} [Y2[ks-XeB(*yzWTVыIvz}ڳ>;^nyqEui ;YbgfBȐҹ_~(?Zo쇧xn~RưڭJN3]aZI,ńwn)w~QU8s6f4E+l'"xO}W|+?5 GPԄ`Yg : <g&ɠT:֫5Ɨ%VSFV\e=j4}w掅 _[&DK-5:ƣ,ฉ|}Y#/?d,ψĞ Z?{I (x1cHʧ9V.gԗmks{F~Ͽ~o KcCռ8< +\nؾGE7J<9gtLEVt.O @?g+߿㹝LG=.Kv^?8_]u|#c'^W4{OR}HA+^xO?e? !|/ L^#V]m,X1>Ñ˭9TRk[?#ࠟ|#~_t;SP|5GXK#vIOw~'|! ?<?7 !K}FF ` 2Hx⿡+%E/=yo#GE~š&ƅizu_yYxi|3~0|1 qѠBHlqj~? u/Pω'ѕuԶ_2^o8eܧ O}j+h~;GM)-VVhRnp9*(t;%CTvZq1F4|]Ʊ _A&_i66`?eAf\auK"kqC]'eu6 25-ETiUoK,KwC:mԷմYZFho1ERHsw?| Ş'uľ/& >@Ьr[6%Bk#_RZ׌-amKy rnz'ȹr,JRMj\a>&~":BtzYTҢW[EwP՞>xzŶOlg쳷nHnsu]ÿ-?V}]1 k0H`#\)Q'g?lQRZӅ>O߷.}J'tLDmkf# ~%|\>"<k׼KZn-I²91k۾xR+~'nZ7^#% l nG\,-_ gs^l$m0fX(b=7 %NI>V1!KVVo[|W_=%yqmc ė^IFs՘)w5o0l3OxC7>"{r(V_&32kit^[_^xZ{^C%ܡU xrkfd14QEyaEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPE?5__/hLSZ4 &.\mVDZ9+J-49؏ϿcxlHpe=},f5fNJPkog s׊iuMkJ6q!/Dr*yP5k/:1o zfGCiV`T&RO~?J~S|T//^)ΞZ[OgY-` Q`ڳLdgDj G'ҿ$|;?x]?oO!jZśxC!\2ϐdĀ Who~.+}/'#]Z]^jkO5-ǺWG,Dh6NIp> s[T䳼텳"4. ̈DJIKՓh=oOx5gPuگ\`|Gjg*>b<7|t~ҞšF'fyhjypx:)ՖOۙnI#ڊ/V~=4_7v~/+CyܾZ`u~n|=KX+xSO_S\ٽrF@]o"_ ~]ok{#=!t< ;n5ca꭯k@Tҿ+hMC? gOٟu_CV-Cwy%TiI] #L@a6:_X !?/c'u?1.#mj> oX{j L~1|'nWŬ7ww7 y%0#9ϭ} _ x7wGO H=_Br jNv d}Nt-:gz'5=70~2XhG/HŽnŷyJMs'1(إsw TnmDҹpW?t$'ӭ|OϋM 4%յ;>K\-6cMO;sXm9/'4[ɭƗ{,Su} I#% $ث眊Un-vI#iat3sWm+e>!|?c֛~YVkP2a*ʡQ]iB(-+gχ~/&+'÷$iV'?wO|_xfm9遀9=sK jIh?2Ե.Mk CliO W?z(W\_r3 Ɠ>,t2dsZmZczj۷8ӊ%S?ΝhNvE|@D~˿.+_xھvbo9'wh?ڤ?i/ jRjZfko#|^H칩u%g+h^op4"|h.M΃oAn4;i !9 dl*6_ k4㿃>>[SW/jŢxC?5'\<[p"n ޷~MWo;P~p~ kZڳN MEQ<Χ+ο/|6/CDHȟ *T|/ᯌ)>xocxQo Z-,Wk}9bn[ 0⫙+SO{^zcį_+߄:ߊ/Zb#FU IG5~PLmkTWrxnf$ -OcV, 5[B7ٵXtQEhsQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@s.㯆:IiX K"`r].*Qiʌd+ cǺĸ}z$ж$o.vgPc@;gfO+꟰ß j^4YxdZK97c'vHtԢo&q>Y/٭kqhVRj#ݢp ;K{R>xGJe}4DD$~덠:WQZ8E[wwI+V¾1~ zn/D(E>g6Ě[x-~B_iZ4_.eRIO :q߆jkտwoK7'|EO^(cdxXaqӐ8ǯ|9/V"Եef-VgRds_BQTkt39ߙoc{o?|MkZAXkqisyW6fFʿ b_z㯍^8 3M^(2(OG# krpGTT5!Vcd?8~?o>;VA O__McT-mY8Tqo "cjhxTrVgTCxpCF1_]QG/SQ_'w'|C xW<}kxRZyv˟-T!*z?^o7I^2M-2v"b[zg}E OMR]j;i|}~>+YTqk5Y}HF$9ϥ|,#ޫ>&h:|~ԦIy`>OHSFO]ezMFj]Ki(8vh2ֱ62ڼȹhĈWpaf=Sڦד^đ]3=¸Q;ZB1:q߆q($_aߴwÿ@񷅥;w_j7P4^\v3)#ےK9}{ ۡj xww<xXfo- YN `s?G(4; 3Cg7]:\D#IY$vI<_6N;ڧVῊ^4Skk/ &5Q oA9?oQU8FN ??n_s?tZ}gſtK%->dkĒP+[&xako>C|A?m,o V Т6Vuz;|n_û'?g]sZ5-?Ckp,*܀ArG G&k_3i~2wiQ::_iv4Yfv:c𯲨٥w=KZ9 l~&x]zI#Fgi#x c6FzO?ax{]=?'/>.x㧆|So7怜amϰr;ƽq^_n^5jx@O}` o(b !U(_~QU77ܟmR_Giqn|vO^IxCCK6[1[;Nk{5a6 FE乒Mec[|Ci\sھ¢?K[{|~ɺOٷR~7M925 f^~^"w֔QVn39ͦ+|($((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((Ϙ+t;_LRxZlQg{),.N$Pnqrխm{k~g~kt,ާ R$%+[rF79) ̾?kWu[OvESBrCN9ͤ/OQI~t>_z\0c2dF۶;vP.x9> /?~}Ύ +Ml2HenH8*}y^iX!myyzQ_4|ֵ^x#4M2e[DK°X'8ۻ1~<|J5 k1k ^h^Ԧќnʸ$!bhhFZ0e%ko>g&^G &2k =d,[V&%,eVbrpXZx ?|9|3yLaV)%[l9o~«M}UExݏo7> Monj?o޷*d_ƻr6 ZyJߍ5&M=>K.ZFcƛRf+/xGOۭ?O{wh ,,3N8֛릿'V>={:ԍ7d-_.Dw+c-? '%f8lnuփ ;Oܱ2q'0P`F VvFi[W{msܨ|5mCޗP]֣mvffcĄ+8 c$t_/ڦ#OٚE~\~g,c=>J$ֻߩ.Hߙl+!757ǟKOQ=+w_fZGڔWŸ $.OF5z>I5/_chHTkCsm>^֞VImoc*+='xV̺^g|V0yI}3.1@ $7u cKOG⏇:t}P#QYX <|l7ԾBYtqB2~f* H 6Vk[5mm~C\[lugxZqm6FibPW~B xWECOWT/>Ř`uX1+\U'(K zN1[w}6>!xWšF+iͅ^lpq@,˸6 3@ůZý=CR7ksm#BcWf%2̓Zь_u* pݟWϷ '|-NrLk\F#H!hsaW$c~2|IX^Id[T*fBGRr 7RqR!N6]4s:_ nV奲|'l 1`LW~;&fu>PxY?ΟtM_Е]v=]>+Ret/<۝?z~| ɤehd"uiV5[gkz[w?E(աkbJԵ;H?nn'-cVDfp w^ _?,>- [Q2#TrYv>K(ܪ8Niu{N7۵/#s[9յ;? F +-K}ZgT<BWw:Ƌa ĺ}Y )ush`*cYIditʖ^6>Hּ{SǚzhwS4o= (;S>3x#>𾛡_Zt#67Fѷ(V S]mo~tT&W_w¾w YuEe9` UPo7_qX{9Iߺ$.m,|~.yb 9NvOg.jjTΒ*ȁ\X`nn{ik䋕K^ΩIG_tm(wp.bpv  v<2jBk+fٮok61yۻjm=v9] kMݺv=ڊoZnn/{{ <.X(Ԕ`pu_wt&R~_1.7(#0=he-T!~I;|no?ǿg|uO>mhZ3l,H`@=OGė_eMgP>F 3R-;ibr ` oέe~#IQN܏mj})E|7I$~ӵo64 ^PI#l; n?imh|3m4,e|?.F U`O[ؗ߷Mϧ(|_qV+/RZ"ʻT-ln8gڷu!'¶յ 2Y]>M`AcPߌt=DMZ)ЩttE@.]'Ѯ#]KLmCnȤ$, np6u~Z㠅0FIc-"]+ +y4- ml-6T@Oʋ'Oj^۴jzwşa>&]xO~Ωe_9DL$nϴHOm xoZuW[Qӎ$YFxPNAQZM]`I6E~}|Z7o0x>ÑafwiT,Z ιQWo-~j^&ȐGY.h\[Y$#ghw}4Ϲ5v )&icm.~nVi))`0qpGx#>'Y傕9U!)_9Uki˽z9(9(9(+%|U'< ,KLͭgR ibqU75P*tWڶF?g[%I %A&ͪr>޾OѾ±m ::B]ʈ˟o* u@)7}cJxSm7ѵf|G㏇>2?@n<`&imu/+yЖfQK`+8#p }~ߺ]L߸2FO.bF֢i^[OIŦڵϟx*R/WI쉢3fw1 DJ.9o :׉EnG7 Pc%Eg`t(l}馻ɸk_sse}[H >G {sl¥/6yxϋ<x{+nu]<(QVk3}SȒIu|@xKx4^_jOͧ^*#b+$Io|W_#:DŽt=FZ'ayeF ,OO-}}Egtw^'k>X}؋úa]d:Ig)7y{~oc_?x<?¸*jQe(1" lfJ(~ጔ\{!XejpUc_:<7sDռ7eS^ d++FfPY0Xv$?@+̴>gǖWƧ4m0Q֊J'<=Xҧ%kw>^[?5OnidVbDXN#$z`fKxCt*=la4Y |3}E WzyK{ CB⟆կ{\\[mWp ֬H!T ׫IcZoiL%'.dk'KM#e wG! rq_bQS+K[26M+YG Yƞ2t]M||w6du"'a ɉqҽ?|E^){G ڋ[WI|#ll7e\WQbzl^x$%^WT?-:Ư 2ix2]Vԗ?_֛3_I%PF7 ц b)R mj(to{>߂}mOV~{ٿhx|7t; o./ynu+):227ldT\{Kkڦ·?i:] o,sӭ{U)Y_Ko[{]ҽ 1i7E,mUa|JĖ|>Ɨ"yWlru}8f -5N̝3_8t>A/ןI\ӎAi2i'sTn8)W?n/iG)QGNFٯ(IrY[幻JM$i۵>GkG?$C.iz%K7H܆$8 q#G7{]?o$+(rC_tQU3i1RZ_>IGE0ޮ$ֿy<7J|W1Yx?\x5 oss_2䍔FBz3_Vܯ4[C(${j4 ꍢO<7wgeuc!iLp6`VFŭO&_ x [:C!9xPIշ_pQS#k_Ko[rZ7dN>K5 8CGiM줉%e @ln^o?F5π6z.y^ ^ 63 -8+I炍~ ۺX_ⷄ|U/k_UҚ;mdݶCuU%Cp}+׼3)#6j bnmɷh`rx5>]>>}j\m~A_ğO h~(ndfedr|B @K~΢O%gFn/3z</~/l뺈y]aU^O2ؓ0 y?.,ռ'_7(Ac4z@-k} [YN̮n!siw86{zh>+3u'0ZنHHfK3 pH3j]Ε^2K<7 T*U8I{%>Kny-i?Fyp.C$i4+s]XgGi~uO蚦>IL,E8}ʊTTktmO*U{YKx?^d1jq{Ϝ"*GvPU?5|G2m{n `ɐgL\V^ǻ~wL]5/|?M WV-IsgI$d[N`+>Aox#ķ^"> +Vq^%ʘT6N9[?VjRR/)VիǞk?dž/u]XYycsF>pq:|!ώ,_GKKJ c`P.X ۲+*IB|_s9e:|WMKc3~">#?Eubs'$e2FFB }~: iDo D4)&kHhw-u[vex8o iEeo'.u6|A6\%.ucwCoGF9lJ(#rԩ'k>c;c^0uw1-8m$)q[? ~$|3x6H5 ;ox,&9yh +w8:4TVeoTuO)4ٮ|I?47(dkVn-ve4)X=I2+FZӼLN!61.A䝤  EO/v+;c22Yھ 7|PVwKXncHbǕ N3]]pG9+$ԭ9_|.h5{g݌} 3]oM g$qjJV-)™#i=+2AFl[{Kx(bAEPV+pe8Ui*ӭuk_V|i;Wtz⢩RWߪv}rWZmş%~"xW\u+%o㱑ڭ13M{޾>? z wLvWkdF WT ua٢kZ/"6P䍮1ojƞRydU$2mTpzw}ElR}/TʔZUk>׼!υ?~&?-_w'{m+OyQb[sH\Y/jW hA,g1+3 m_eYI[]קcomZ>,w74I"K$weH|4vFVHeH9xXρ~2xZgu)I+ňʩ j_{?lh~%^`GdDP-@3`T(ϛmپ-S>^G&gT]?(@>ByBO Ɠjqi[aYvxeݮ]|D'qZk*nn7Y" @ >ς-~Qn,}+zE-v@(V`Hߕ*wu8Ӝ+jխ~wR%&M[55~|h#^4 l!i鷺*" :WWſ~H-I(j@+ZMR{^!:-?Ah̿xJxk^jvFZ+L~` U ޵j,"ZzakBx*F1s j(r߭kƊ>&>oj7zge֨ѯZXs p-ß5{ۋhU |Ԅp,Aq=9m38+vgmϳޡ6:%/2>6c1#=;צW>u $`rp$ו6|}k]Sğ5 >[} %FG$Tb1M4XXm'd{'ᇄom$ ; 3v@c^:֣βC]Iw=Jb *yڻ+>#^x C_$~;tNȕ[%iy$ 5TO8^ͫ.W]S▛_x&wZUv}!{FUsqGA-xZ [8,IJ,%B 7fےHO8>*K-]l~ftE'1% ~U/ۧ:o n@ =+w}6ZF-+ݮ޶>k;E{Z.&g<? }Ӑ1\]oG?S6ח)o6 أvbA 9>t4{AR8dՕ[ $J}{_^|{sOM7MDYW,K1>ɵu_РR:kɯ>1i /IGĞ!ᰂ_(* mw3d*9nk+4R F 26ߘ ϊ^$txAoɤ+Fr:FRѪ,@>[~*g 4xim8-XḽT )*ַM{Ɲ7B򍝴wտNW_o^4JF2ZJ|T/XaT:gs|2#v\Xm:dW®Hn^zp+Ju9k]]#Jn)kmczUmsK֯\Iʱc*wW'$1_>WEuH| do5Ip3,* H$DΤm{eRSrnME|9֭_NChjXmIQy% +|W4^h"Ɇf}+k;GPM0ETꪓϽ*a=.~e{&ש54 _5{_js,WV*:nBVBĀ9"3I?i:OtՒ{Gh@UUs!HPv䟚~Ӗ;ȧB3ݭ+L>6!xrTZydVŁwb9:u7u⯁kz_[i\bisH!" ]{t8Ic$<+}7~.IN/0cj9ixgV<?aM\-$mmʧޢ9t[;χ?74k=_öѽA-H YJW6&xrmbH^He] 9ۏp{vv$ޖN}E|oVg >wN3:!k.d`x~FqhZkڜtY7yxŸ7+O!+i0 viW?Rϊ߂^gkN#II.c PZx۪΋}kMүGyy KkapΪ+=kuk~<涉:u?@&H(Y0N1ߌhƽ{Mo2NrYwĜ_/|Dc03hVZu _+9< ^N gcx1U9TWW>+((((((((((((((((((((((( zZ}ζv]J2pke[jӄ3ZR*vF|?gOi~dkDP+H˒~bFyy'_Z i41rD@'E\g ]:w~"4o:}>ko:3 R#^Fтi'||oj+qq4gVBaP?vT?QS-=[ߛk⺗?CXM+GkicL#30rb*@.qԞ3\iڕޟdkqepFpH6RWT)r٨ӄ7ꖀUMjxxCQlVm3,08e8淒DUe<GpiU$KM9Tq_)>0O%U>qz}3Ѵk821jNI$I$I5ELa%bVsgx?O|^Fyjw4m;Ƥ| ^ڊ*J*=rrrn;ῂ>]?P6Mizn'5`09ۇN)_<'a3V6ޭ<eـ" kIT8[m-ooow{k\=W5w;db|?p`q|ˤYc4<]D-XS hspF: _BQRǦ{-b*ݽw>5W_k Ηso3K"TS"!23WuIe%`ݜ;3f ۫Z*U($[+,L'${h῅n}ܷGeb8!k7'­aƽjqXo0aE/gm-o`]ݧ[}nj7p ~tk@^x m64kڒCcrU8?pT`58=-~VNϯv4sqY_i$*]FDpnrm3uV;FM_S f30Qֽ:=˿ګM6GG<>ꚅ uph4oHk|ہpc#q4׻΍W[v-+*}7E}f]{3| 𮭪x>S< kcxTH?uJOŸ$|Lf?凝y?wy}M䍶yޥoctQ;+N[vI捣A3,-\֗ÿz=QnὙeʎʻF݈}s^ELc[彾JI_[VQEhbQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQESѶٍ)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y)h@Y(Š(((((((((((((((((((((((((((((((((((((((((((((((